Influence of performance level on anaerobic power and body composition in elite male judoists

This study examined the relationship between 30-second anaerobic power and body composition by performance level in elite Judoists. During a 3-month period, 10 male Korean Judo national team athletes (NT), 26 male university varsity team athletes (VT), and 28 male junior varsity team athletes (JT) were assessed for 30-second anaerobic power and body composition at the Youngin University. Anaerobic power was measured using a 30-second Wingate test. Body composition was assessed via bioelectric impedance analysis in standardized conditions using BioSpace (Korean)-specific prediction formulas. All testing occurred at the beginning of the winter nonseason period but excluded a brief weight-loss period before the competition phase. Anaerobic power measures were significantly greater (p < 0.05) in NT and VT than in JT. Fat-free mass (FFM), muscle mass (MM), and total body water in JT were also greater than in VT and JT (p < 0.05). Muscle mass in VT was significantly lower than in NT (p < 0.05). Fat-free mass in NT was strongly correlated to mean and peak anaerobic power (r = 0.77, p = 0.009; r = 0.87, p < 0.001, respectively). Varsity team athletes also indicated a moderate association between FFM and peak and mean anaerobic power (r = 0.63, p < 0.001; r = 0.48, p = 0.013, respectively). However, relationship between FFM and anaerobic power was not statistically significantly correlated in JT (r = 0.14, p = 0.470; r = 0.23, p = 0.232, separately). In conclusion, our data indicated that anaerobic power is closely correlated with increase in FFM and MM and was different dependent among performance levels. Further research in the field is warranted to elucidate the Judo-specific relationship between FFM and performance.     

Bone morphogenetic protein-1 processes insulin-like growth factor-binding protein 3

The bone morphogenetic protein-1 (BMP1)-like metalloproteinases play key roles in extracellular matrix formation, by converting precursors into mature functional proteins involved in forming the extracellular matrix. The BMP1-like proteinases also play roles in activating growth factors, such as BMP2/4, myostatin, growth differentiation factor 11, and transforming growth factor β1, by cleaving extracellular antagonists. The extracellular insulin-like growth factor-binding proteins (IGFBPs) are involved in regulating the effects of insulin-like growth factors (IGFs) on growth, development, and metabolism. Of the six IGFBPs, IGFBP3 has the greatest interaction with the large pool of circulating IGFs. It is also produced locally in tissues and is itself regulated by proteolytic processing. Here, we show that BMP1 cleaves human and mouse IGFBP3 at a single conserved site, resulting in markedly reduced ability of cleaved IGFBP3 to bind IGF-I or to block IGF-I-induced cell signaling. In contrast, such cleavage is shown to result in enhanced IGF-I-independent ability of cleaved IGFBP3 to block FGF-induced proliferation and to induce Smad phosphorylation. Consistent with in vivo roles for such cleavage, it is shown that, whereas wild type mouse embryo fibroblasts (MEFs) produce cleaved IGFBP3, MEFs doubly null for the Bmp1 gene and for the Tll1 gene, which encodes the related metalloproteinase mammalian Tolloid-like 1 (mTLL1), produce only unprocessed IGFBP3, thus demonstrating endogenous BMP1-related proteinases to be responsible for IGFBP3-processing activity in MEFs. Similarly, in zebrafish embryos, overexpression of Bmp1a is shown to reverse an Igfbp3-induced phenotype, consistent with the ability of BMP1-like proteinases to cleave IGFBP3 in vivo.     

Visfatin induces sickness responses in the brain

Background/Objective

Visfatin, also known as nicotiamide phosphoribosyltransferase or pre-B cell colony enhancing factor, is a pro-inflammatory cytokine whose serum level is increased in sepsis and cancer as well as in obesity. Here we report a pro-inflammatory role of visfatin in the brain, to mediate sickness responses including anorexia, hyperthermia and hypoactivity.

Methodology

Rats were intracerebroventricularly (ICV) injected with visfatin, and changes in food intake, body weight, body temperature and locomotor activity were monitored. Real-time PCR was applied to determine the expressions of pro-inflammatory cytokines, proopiomelanocortin (POMC) and prostaglandin-synthesizing enzymes in their brain. To determine the roles of cyclooxygenase (COX) and melanocortin in the visfatin action, rats were ICV-injected with visfatin with or without SHU9119, a melanocortin receptor antagonist, or indomethacin, a COX inhibitor, and their sickness behaviors were evaluated.

Principal Findings

Administration of visfatin decreased food intake, body weight and locomotor activity and increased body temperature. Visfatin evoked significant increases in the levels of pro-inflammatory cytokines, prostaglandin-synthesizing enzymes and POMC, an anorexigenic neuropeptide. Indomethacin attenuated the effects of visfatin on hyperthermia and hypoactivity, but not anorexia. Further, SHU9119 blocked visfatin-induced anorexia but did not affect hyperthermia or hypoactivity.

Conclusions

Visfatin induced sickness responses via regulation of COX and the melanocortin pathway in the brain.     

Mesenchymal stromal cells are present in the heart and promote growth of adult stem cells in vitro

Background aimsFor many years the human heart has been considered a terminally differentiated organ with no regenerative potential after injury. Recent studies, however, have cast doubt on this long-standing dogma. The objective of this study was to investigate the presence of and characterize mesenchymal stromal cells (MSC) in the adult mouse heart. The impact of MSC on growth and differentiation of adult cardiac stem cells (CSC) was also analyzed.MethodsA combination of lineage-negative/c-kit-negative (Lin^?/c-kit^?) immunoselection with a plastic-adhesion technique was used to isolate cardiac-derived MSC. The differentiation capacity and expression of surface markers were analyzed. To investigate the impact of MSC on growth and differentiation of adult CSC, Green Fluorescent Protein (GFP⁺) adult CSC were co-cultured with GFP^? cardiac-derived MSCResultsMSC were present in the adult mouse heart and they met the criteria established to define mouse MSC. They expressed surface markers and were able to differentiate, in a controlled manner, into multiple lineages. In addition, cardiac-derived MSC promoted the survival and expansion of adult CSC in vitroConclusionsMSC can be isolated from the mouse heart and they promote growth and differentiation of adult CSC. The findings from this study could have a significant beneficial impact on future heart failure treatment. Co-culture and co-implantation of cardiac-derived MSC with adult CSC could provide extensive cardiac regeneration and maintenance of the CSC population after implanted into the heart.     

Mechanistic analysis of a DNA damage-induced, PTEN-dependent size checkpoint in human cells

Following DNA damage, human cells undergo arrests in the G(1) and G(2) phases of the cell cycle and a simultaneous arrest in cell size. We previously demonstrated that the cell size arrest can be uncoupled from the cell cycle arrest by mutational inactivation of the PTEN tumor suppressor gene. Here we show that the cell size checkpoint is inducible by DNA-damaging chemotherapeutic agents as well as by ionizing radiation and is effectively regulated by PTEN but not by its oncogenic counterpart, PIK3CA. Mutational analysis of PTEN and pharmacological inhibition of Akt revealed that modulation of Akt phosphorylation is unnecessary for cell size checkpoint control. To discover putative PTEN regulators and/or effectors involved in size checkpoint control, we employed a novel endogenous epitope tagging (EET) approach, which revealed that endogenous PTEN interacts at the membrane with an actin-remodeling complex that includes actin, gelsolin, and EPLIN. Pharmacological inhibition of actin remodeling in PTEN(+/+) cells recapitulated the lack of size checkpoint control seen in PTEN(-/-) cells. Taken together, these results provide further support for the existence of a DNA damage-inducible size checkpoint that is regulated by a major tumor suppressor, and they provide a novel Akt-independent mechanism by which PTEN controls cell size.     

Synthesis of the transferrin receptor by cultures of embryonic chicken spinal neurons

We have purified a glycoprotein from chicken sciatic nerves, sciatin, which has pronounced trophic effects on avian skeletal muscle cells in culture. Recent studies have shown that sciatin is identical to the iron-transport protein, transferrin, in terms of its physicochemical structure, immunological reactivity, and biological activity. To determine whether transferrin is synthesized and released by neuronal tissue, we incubated cultures of dissociated chicken spinal neurons in a medium free of L-leucine containing either L-3H-amino acids or L-[14C]leucine and immunoprecipitated transferrin with highly specific antibodies. The radiolabeled protein precipitated by rabbit heteroclonal, goat heteroclonal, or mouse monoclonal antitransferrin antibodies increased in specific activity in a linear manner for at least 30 min. Synthesis of this protein was abolished by the presence of puromycin (20 micrograms/ml) or cycloheximide (10(-5) M). The disappearance of the radiolabeled protein from cells was linear with a half-life (t 1/2) of 8-10 h. When immunoprecipitates were separated by SDS gel electrophoresis, a prominent band corresponding to transferrin (Mr 84,000) was visualized by staining with Coomassie Blue. However, when such gels were fluorographed, no radioactivity was apparent in the transferrin region of the gel although a prominent radioactive band was visualized at an Mr of 56,000. The protein of Mr 56,000 was not simply a degradation product of transferrin because this particular protein band was not generated by incubating radiolabeled transferrin with unlabeled neuronal homogenates. The protein of Mr 56,000 was purified from embryonic chicken brain and spinal cord by immunoabsorption chromatography on mouse monoclonal antitransferrin IgG conjugated to Sepharose 4B followed by affinity chromatography on immobilized transferrin. The purified protein bound radioiodinated transferrin and was precipitated by rabbit anti-chicken transferrin-receptor antibodies. Furthermore, this receptor protein was found to be localized on the plasma membrane of dorsal root ganglion neurons by immunocytochemistry using the peroxidase-antiperoxidase technique, and by blocking experiments, which showed that antitransferrin receptor IgG could inhibit the binding of fluorescein-conjugated transferrin at 4 degrees C to cultured neurons in vitro. From these data, we conclude that transferrin is not synthesized by cultures of chicken spinal cord neurons, but that the receptor for transferrin is synthesized by these cultures and is precipitated by antitransferrin antibodies as an antigen-receptor complex.     

Structural properties of periplasmic SodCI that correlate with virulence in Salmonella enterica serovar Typhimurium

Salmonella enterica strains survive and propagate in macrophages by both circumventing and resisting the antibacterial effectors normally delivered to the phagosome. An important aspect of Salmonella resistance is the production of periplasmic superoxide dismutase to combat phagocytic superoxide. S. enterica serovar Typhimurium strain 14028 produces two periplasmic superoxide dismutases: SodCI and SodCII. Both enzymes are produced during infection, but only SodCI contributes to virulence in the animal. Although 60% identical to SodCII at the amino acid level with very similar enzymatic properties, SodCI is dimeric, protease resistant, and tethered within the periplasm via a noncovalent interaction. In contrast, SodCII is monomeric and protease sensitive and is released from the periplasm normally by osmotic shock. We have constructed an enzymatically active monomeric SodCI enzyme by site-directed mutagenesis. The resulting protein was released by osmotic shock and sensitive to protease and could not complement the loss of wild-type dimeric SodCI during infection. To distinguish which property is most critical during infection, we cloned and characterized related SodC proteins from a variety of bacteria. Brucella abortus SodC was monomeric and released by osmotic shock but was protease resistant and could complement SodCI in the animal. These data suggest that protease resistance is a critical property that allows SodCI to function in the harsh environment of the phagosome to combat phagocytic superoxide. We propose a model to account for the various properties of SodCI and how they contribute to bacterial survival in the phagosome.     

Expansion of symmetric exon-bordering domains does not explain evolution of lineage specific genes in mammals

In order to examine the evolution of lineage specific genes, we analyzed intron phase distributions and exon-bordering domains in primate and rodent specific genes. We found that the expansion of symmetric exon-bordering domains could not explain the evolution of lineage specific genes. Rather internal intron loss of a domain can partially explain the excess of class 1–1 intron phases in the lineage specific genes. We suggest the event that led to excess of symmetric exons in lineage specific genes had little bearing on shaping the phenotypes specific to the individual lineage. Instead, Kruppel-associated box (KRAB) proteins associated with zinc finger C2H2 (zf-C2H2) type are likely to be responsible for the lineage specific function.     

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K_d [kanamycin] = 78.8 nM, K_d [kanamycin B] = 84.5 nM, and K_d [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.