Effect of temperature on the stability and activity of crystalline ox liver nuclear and mitochondrial glutamate dehydrogenases

A study on the response of the stability and activity of crystalline ox liver nuclear and mitochondrial glutamate dehydrogenases to temperature variations has been carried out. The thermodynamic properties of the heat inactivation process and of the reaction with the substrates glutamate and α-ketoglutarate have been investigated. The heat inactivation of nuclear glutamate dehydrogenase proceeds at a faster rate than that of the mitochondrial enzyme in the temperature range 40–51 °C; the enthalpy of activation of the inactivation process is higher and the entropy is almost double, compared to the values of mitochondrial glutamate dehydrogenase. The effect of temperature on the maximal velocity shows that, with both glutamate and α-ketoglutarate, the enthalpy of activation with nuclear glutamate dehydrogenase is double and the decrease in entropy almost half of the values of the mitochondrial enzyme. The variation of the apparent K_m with temperature shows a decrease of the affinity of both enzymes for glutamate, with no major difference in the thermodynamic properties of the reaction. With α-ketoglutarate, on the other hand, the affinity of nuclear glutamate dehydrogenase decreased, whereas that of the mitochondrial enzyme increased with temperature. The process is therefore exothermic with the former enzyme, endothermic with the latter; furthermore, it occurs with a decrease in enthropy with nuclear glutamate dehydrogenase, but with a large increase with the mitochondrial enzyme. The studies on the effect of temperature on the activity were carried out in the range 20–44 °C.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

R-factor-mediated suppression of the galactose-sensitive phenotype of Escherichia coli K-12 galE mutants

Plasmids S-a and Rts1 suppress the galactose-sensitive phenotype of galE mutants of Escherichia coli K-12, giving rise to both galactose-fermenting and nonfermenting strains. Fermenting strains produce normal inducible UDP-galactose epimerase. Plasmids extracted from either a fermenting or a nonfermenting strain are indistinguishable when examined by either measurements of length of relaxed circular molecules by electron microscopy or electrophoretic pattern of restriction endonuclease digestion products. The phenomenon could be explained by reversible recombination between a plasmid-borne epimerase gene and homologous chromosomal sequences.     

Iron . bleomycin . DNA system evidence of a long-lived bleomycin . iron . oxygen intermediate

When Fe(II) is added to a bleomycin. DNA mixture in the presence of air a long-lived $\text{(}\text{t}{}_{\mathrm{<mtext>1</mtext><mtext>2</mtext>}}\text{= 45}\text{minutes}\text{)}$ EPR silent species (I′) is formed; the circular dichroism and absorption spectra of which have been characterized. This complex slowly decays yielding a ferric complex (III′) analogous to the well known low spin Fe(III). BLM species.     

β-d-glucosidase-catalysed transfer of the glycosyl group from aryl β-d-gluco- and β-d-xylo-pyranosides to phenols

The effect of phenols on the hydrolysis of substituted phenyl β-d-gluco- and β-d-xylo-pyranosides by β-d-glucosidase from Stachybotrys atra has been investigated. Depending on the glycon part of the substrate and on the phenol substituent, the hydrolysis is either inhibited or activated. With aryl β-d-xylopyranosides, transfer of the xylosyl residue to the phenol, with the formation of new phenyl β-d-xylopyranosides, is observed. With aryl β-d-glucopyranosides, such transfer does not occur when phenols are used as acceptors, but it does occur with anilines. A two-step mechanism, in which the first step is partially reversible, is proposed to explain these observations. A qualitative analysis of the various factors determining the overall effect of the phenol is given.     

Steroid modulation of oxytocin/vasopressin receptors in the uterus

Oxytocin (OT) and V1 vasopressin (VP) receptors are present simultaneously in several tissues, including the uterus. In myometrium these receptors mediate contractility, while in endometrium they mediate the release of other uterotonic substances as endothelin (ET). In rabbit myometrium, estrogens increase, while progesterone blunts neurohypophysial hormone receptors. However, the action of sex steroids on OT and V1 VP receptors differs in terms of the ED₅₀ and maximal effect. Therefore, at parturition, only OT receptors show a dramatic rise, while V1 VP receptors do not change, suggesting a major role for OT in labor. ET is a potent stimulator of uterine activity acting through specific receptors present on myometrial cells. These receptors as well as the endometrial localization of ET are modulated by sex steroids, indicating that ET might represent a paracrine regulator of uterine activity. In humans, OT but not V1 VP receptors increase as pregnancy progresses, confirming the primary relevance of OT in timing delivery.     

Intercellular adhesion molecule-1 (ICAM-1)-dependent and ICAM-1-independent adhesive interactions between polymorphonuclear leukocytes and human airway epithelial cells infected with parainfluenza virus type 2.

Acute respiratory virus infections are often associated with an early influx of neutrophils (PMN) into the airways. Maximal cytoxic injury by PMN depends on tight cell-cell adhesion. Infection of some cell types by respiratory and other viruses has been shown to increase PMN adhesion to these cells by undefined mechanisms. We studied adhesion by human PMN to monolayers of primary (1 degree) human tracheal epithelial cells (TEC) or an immortalized cell line derived from human TEC, 9HTEo-, that had been infected with parainfluenza virus type 2 (PiV2). PMN adhesion to uninfected 1 degree TEC was very low (< 5%), but PMN adhesion to PiV2-infected 1 degree TEC was greatly increased (89 +/- 7%). PMN adhesion to 9HTEo- cells was 47 +/- 6%, but increased, 87 +/- 8%, for PiV2-infected 9HTEo- cells. Surface intercellular adhesion molecule-1 (ICAM-1) expression on 1 degree TEC, as determined by immunofluorescence flow cytometry, was relatively low (23 fluorescence units) but doubled by 24 h after PiV2 infection and tripled by 48 h. The 9HTEo- cells constitutively expressed higher levels of surface ICAM-1 (120 units) which did not increase with PiV2 infection. Treatment of non-PiV2-infected 9HTEo- cells with mAb (R6.5) to ICAM-1 reduced PMN adhesion to these cells from 47 +/- 8 to 23 +/- 5%. Identical mAb treatment of either 1 degree TEC or 9HTEo- cells infected with PiV2 had no significant effect on PMN adhesion. Treatment of the PMN with mAb against CD11a, CD11b, or CD18 markedly reduced PMN adhesion to PiV2-infected 1 degree TEC and 9HTEo- cells. We conclude that PiV2 infection of human TEC causes a marked increase in their adhesive interactions with PMN by inducing increased surface expression of both ICAM-1 and one or more, as yet uncharacterized, non-ICAM-1 adhesion molecules that function as counter-receptors for CD11/CD18 on PMN. These mechanisms of adhesion may play a role in epithelial damage during acute respiratory virus infections.     

Ploidy reduction and genome segregation in cultured carrot cell lines. I. Prophase chromosome reduction

Cytological analysis of different carrot cell lines in culture has shown various cytogenetic anomalies generating new levels of ploidy and novel chromosome numbers. Polyploidy may be considered a reservoir of variability that can be released in the form of distinct new segregants of different ploidy. Mechanisms alternative to mitosis (reductional grouping, prophase chromosome reduction) operate from a polyploid state (possibly reached by means of endopolyploidy, endomitosis, nuclear fusion, or restitution nuclei) to generate new levels of ploidy and novel chromosome numbers necessary for selection to operate in vitro. The segregational phenomena require chromosome recognition in haploid set complements and abnormal behaviour of mitoses; the resulting chromosome variability suggests that chromosomes are arranged, in the resting nuclei, in an orderly and predictable manner.The knowledge of the molecular events governing these mechanisms, and how to control them, would be of great help for future applications of plant cell culture.