A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

R-factor-mediated suppression of the galactose-sensitive phenotype of Escherichia coli K-12 galE mutants

Plasmids S-a and Rts1 suppress the galactose-sensitive phenotype of galE mutants of Escherichia coli K-12, giving rise to both galactose-fermenting and nonfermenting strains. Fermenting strains produce normal inducible UDP-galactose epimerase. Plasmids extracted from either a fermenting or a nonfermenting strain are indistinguishable when examined by either measurements of length of relaxed circular molecules by electron microscopy or electrophoretic pattern of restriction endonuclease digestion products. The phenomenon could be explained by reversible recombination between a plasmid-borne epimerase gene and homologous chromosomal sequences.     

The enzymatic system thiosulfate: Cytochrome c oxidoreductase from photolithoautotrophically grown Rhodopseudomonas palustris

Rhodopseudomonas palustris cells, characterized by a lamellar type intracytoplasmic chromatophore membrane system after phototrophic growth, yielded a crude supernatant cell-free fraction (S-144) after ultracentrifugation which retained the contents of both the cell compartments. After thiosulfate-dependent growth, a protein system was isolated from S-144 which catalyzed the thiosulfate-linked reduction of an endogenous c-type cytochrome. — The colorless oxidoreductase protein, after purification to homogeneity, revealed a molecular weight of 93,000 and, after SDS treatment, a particle weight of 48,000. It was focused at an average pI of 5.45. Apparent K _m values for several substrates were in the M range. The electron acceptor for thiosulfate oxidation was found to be a cytochrome c from S-144. The homogeneous acceptor protein, at liquid nitrogen temperature, exhibited absorption maxima at 549.0, 518.5 and 418.0 nm, and shoulders at 525.5, 512.0 and 508.0 nm. Its molecular weight was found to be 17,000 (gel filtration) and 16,000 (SDS gel electrophoresis). It was characterized by a pI of 10.0. Its midpoint redox potential of E _m,7.0=+228 mV was determined by redox titrations and the value of +205 mV by spectrophotometric calculations.Abbreviations BSA bovine serum albumin - HiPIP high potential nonheme iron protein - IEF isoclectric focusing - SDS dodecylsulfate, sodium salt - Temed N,N,N,N-tetramethylethylenediamine     

β-d-glucosidase-catalysed transfer of the glycosyl group from aryl β-d-gluco- and β-d-xylo-pyranosides to phenols

The effect of phenols on the hydrolysis of substituted phenyl β-d-gluco- and β-d-xylo-pyranosides by β-d-glucosidase from Stachybotrys atra has been investigated. Depending on the glycon part of the substrate and on the phenol substituent, the hydrolysis is either inhibited or activated. With aryl β-d-xylopyranosides, transfer of the xylosyl residue to the phenol, with the formation of new phenyl β-d-xylopyranosides, is observed. With aryl β-d-glucopyranosides, such transfer does not occur when phenols are used as acceptors, but it does occur with anilines. A two-step mechanism, in which the first step is partially reversible, is proposed to explain these observations. A qualitative analysis of the various factors determining the overall effect of the phenol is given.     

The cytosolic and glycosomal glyceraldehyde-3-phosphate dehydrogenase from Trypanosoma brucei. Kinetic properties and comparison with homologous enzymes

The protozoan haemoflagellate Trypanosoma brucei has two NAD-dependent glyceraldehyde-3-phosphate dehydrogenase isoenzymes, each with a different localization within the cell. One isoenzyme is found in the cytosol, as in other eukaryotes, while the other is found in the glycosome, a microbody-like organelle that fulfils an essential role in glycolysis. The kinetic properties of the purified glycosomal and cytosolic isoenzymes were compared with homologous enzymes from other organisms. Both trypanosome enzymes had pH/activity profiles similar to that of other glyceraldehyde-3-phosphate dehydrogenases, with optimal activity around pH 8.5-9. Only the yeast enzyme showed its maximal activity at a lower pH. The glycosomal enzyme was more sensitive to changes in ionic strength below 0.1 M, while the cytosolic enzyme resembled more the enzymes from rabbit muscle, human erythrocytes and yeast. The affinity for NAD of the glycosomal enzyme was 5-10-fold lower than that of the cytosolic, as well as the other enzymes. A similar, but less pronounced, difference was found for its affinity for NADH. These differences are explained by a number of amino acid substitutions in the NAD-binding domain of the glycosomal isoenzyme. In addition, the effects of suramin, gossypol, agaricic acid and pentalenolactone on the trypanosome enzymes were studied. The trypanocidal drug suramin inhibited both enzymes, but in a different manner. Inhibition of the cytosolic enzyme was competitive with NAD, while in the case of the glycosomal isoenzyme, with NAD as substrate, the drug had an effect both on Km and Vmax. The most potent inhibitor was pentalenolactone, which at micromolar concentrations inhibited the glycosomal enzyme and the enzymes from yeast and Bacillus stearothermophilus in a reversible manner, while the rabbit muscle enzyme was irreversibly inhibited.     

Steroid modulation of oxytocin/vasopressin receptors in the uterus

Oxytocin (OT) and V1 vasopressin (VP) receptors are present simultaneously in several tissues, including the uterus. In myometrium these receptors mediate contractility, while in endometrium they mediate the release of other uterotonic substances as endothelin (ET). In rabbit myometrium, estrogens increase, while progesterone blunts neurohypophysial hormone receptors. However, the action of sex steroids on OT and V1 VP receptors differs in terms of the ED₅₀ and maximal effect. Therefore, at parturition, only OT receptors show a dramatic rise, while V1 VP receptors do not change, suggesting a major role for OT in labor. ET is a potent stimulator of uterine activity acting through specific receptors present on myometrial cells. These receptors as well as the endometrial localization of ET are modulated by sex steroids, indicating that ET might represent a paracrine regulator of uterine activity. In humans, OT but not V1 VP receptors increase as pregnancy progresses, confirming the primary relevance of OT in timing delivery.     

Ploidy reduction and genome segregation in cultured carrot cell lines. I. Prophase chromosome reduction

Cytological analysis of different carrot cell lines in culture has shown various cytogenetic anomalies generating new levels of ploidy and novel chromosome numbers. Polyploidy may be considered a reservoir of variability that can be released in the form of distinct new segregants of different ploidy. Mechanisms alternative to mitosis (reductional grouping, prophase chromosome reduction) operate from a polyploid state (possibly reached by means of endopolyploidy, endomitosis, nuclear fusion, or restitution nuclei) to generate new levels of ploidy and novel chromosome numbers necessary for selection to operate in vitro. The segregational phenomena require chromosome recognition in haploid set complements and abnormal behaviour of mitoses; the resulting chromosome variability suggests that chromosomes are arranged, in the resting nuclei, in an orderly and predictable manner.The knowledge of the molecular events governing these mechanisms, and how to control them, would be of great help for future applications of plant cell culture.     

Anaerobic metabolism of goldfish,Carassius auratus (L.). Influence of anoxia on mass-action ratios of transaminase reactions and levels of ammonia and succinate

Summary Changes in the concentrations of ammonia, glutamate, alanine, aspartate, -ketoglutarate, oxaloacetate and succinate were measured in freeze-clamped lateralred muscle, dorsal white muscle and liver, and in rapidly cooled blood of goldfish after 12 h of anoxia. Alanine accumulation, succinate accumulation and aspartate depletion are observed in all tissues examined; in the liver the concentrations of glutamate increase and those of ammonia decrease. The mass-action ratio of the glutamate-pyruvate transaminase-catalyzed reaction stays within one order of magnitude from thermodynamic equilibrium in the direction of alanine formation. The mass-action ratio of the glutamate-oxaloacetate transaminase reaction is far from equilibrium when measured oxaloacetate concentrations are used. When levels of free oxaloacetate are calculated from LDH and MDH equilibrium constants, the mass-action ratio of glutamate-oxaloacetate transamination is close to equilibrium in the direction of aspartate formation. Since neither alanine nor glutamate decreases, and since ammonia gradients suggest a continuous ammonia production in all tissues examined, anaerobic proteolysis is assumed. A possible coupling between amino acid catabolism and ethanol production is discussed.Abbreviations ALA alanine - ASP aspartate - EDTA ethylene diamine tetraacetate - FP _ox oxidated flavoprotein - FP _red reduced flavoprotein - FUM fumarate - GLU glutamate - GOT glutamate oxaloacetate transaminase - GPT glutamate pyruvate transaminase - IMP inosine monophosphate - KG -ketoglutarate - LDH lactate dehydrogenase - MAL malate - MAR mass action ratio - MDH malate dehydrogenase - OAA oxaloacetate - PYR pyruvate - sAMP adenylosuccinate - SDH succinate dehydrogenase - SUCC succinate     

A laboratory study on the short-term zonal oscillations of the trochid Monodonta turbinata (Born) (Mollusca: Gastropoda)

Zonal oscillations of Monodonta turbinata (Born) were monitored with an actographic device which precluded clustering behaviour. Unfed snails maintained their cyclic pattern of behaviour for up to 8 days under a light-dark cycle which simulated the natural one. Under constant conditions of light or dark, however, the snails ceased migration and occupied a zonal position typical of day and night, respectively. Experiments in diffuse light and with light from below the floor of the experimental tank showed that the downward migration of M. turbinata in the daytime depends on positive geotaxis combined with negative phototaxis whilst the upward migration at night depends on a negative geotaxis. This mechanism is similar to that described in other littoral molluscs. There was no evidence of an endogenous control of rhythmic zonal activity.