The fine structure of HNK-1 (Leu7) positive cells

Summary The ultrastructural characteristics of HNK-1 (Leu7) positive cells, visualized with a peroxidase labelled anti-mouse IgM serum, were analysed. Our investigation demonstrates: 1) the majority of Leu7 positive cells has a low nuclear/cytoplasmic ratio (N/C), an irregular outline, a well developed smooth endoplasmic reticulum, parallel tubular arrays (PTA) and electron dense granules; 2) the minority of Leu7 positive cells has a high N/C, regular profiles and lacks electron dense granules. The presence of two distinct ultrastructural patterns within Leu7 positive cells may represent: 1) the expression of subsequent stages of cell differentiation; 2) two distinct Leu7 positive cell subpopulations.     

Amino acid transport in the rat exocrine pancreas

Summary Amino acid transport and incorporation have been studied in vitro in rat pancreatic lobules after maximal and supramaximal hormonal stimulation with caerulein. Incorporation into proteins was increased already after 30 and 120 min of maximal stimulation, but was decreased after the infusion of a supramaximal dose. Uptake of neutral amino acids was monitored using labeled leucine and -aminoisobutyric acid (AIB). In the case of leucine the free pool was consistently reduced after maximal stimulation, while supramaximal doses led to an increase which could be potentiated by the addition of 2mM tetracaine. Using AIB, a significant increase in the intracellular pool was observed after maximal stimulation, conversely a decrease after supramaximal stimulation. Release of labeled leucine and AIB from preloaded lobules during incubation in the cold was significantly reduced after maximal secretory stimulation, but was found enhanced by 200 to 300 percent after supramaximal stimulation. No fine structural alterations at junctional complexes or at both the lateral and luminal plasma membranes were observed after maximal stimulation except an increased number of exocytotic figures at the luminal face. However, supramaximal stimulation led to progressive rarefaction of the tight junctional network and disintegration of the gap junctions. Concomitantly, an equal distribution of membrane particles on both faces of the plasma membrane together with a random occurrence of exocytotic figures were observed.Supported by a grant from the Deutsche Forschungsgemeinschaft, Bonn-Bad Godesberg (SFB 122, project C 5). Dedicated to Professor Dr. Gerhard Petry, Marburg, on the occasion of his 65th birthday     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Ploidy reduction and genome segregation in cultured carrot cell lines. I. Prophase chromosome reduction

Cytological analysis of different carrot cell lines in culture has shown various cytogenetic anomalies generating new levels of ploidy and novel chromosome numbers. Polyploidy may be considered a reservoir of variability that can be released in the form of distinct new segregants of different ploidy. Mechanisms alternative to mitosis (reductional grouping, prophase chromosome reduction) operate from a polyploid state (possibly reached by means of endopolyploidy, endomitosis, nuclear fusion, or restitution nuclei) to generate new levels of ploidy and novel chromosome numbers necessary for selection to operate in vitro. The segregational phenomena require chromosome recognition in haploid set complements and abnormal behaviour of mitoses; the resulting chromosome variability suggests that chromosomes are arranged, in the resting nuclei, in an orderly and predictable manner.The knowledge of the molecular events governing these mechanisms, and how to control them, would be of great help for future applications of plant cell culture.     

Isolation of a plant glycoprotein involved with control of intercellular recognition

A recognition molecule was isolated from stigmas of S-allele genotype S₂S₂ of Brassica oleracea var. capitata L. After Sephadex chromatography, it eluted as a single symmetrical peak during diethylaminoethane-cellulose chromatography. A high degree of purity was affirmed by: sedimentation as a single peak during ultracentrifugation through 5 to 20% sucrose gradients; elution as a single peak from Sephadex G-100; visualization as a single band which stains with Coomassie blue and periodic acid Schiff reagent after electrophoresis on polyacrylamide gels. Other criteria supporting the conclusion that it is a glycoprotein are: (a) the highly purified preparation is anthrone-positive and has a Lowry protein to anthrone-positive carbohydrate ratio of 1.3; (b) the preparation contains arabinose, galactose, glucose, and mannose, although it is not precipitated by concanavalin A; (c) the immunological properties of the molecule are lost following protease treatment, and it has a molecular weight of 90,000 by Sephadex gel-filtration analysis and 54,500 by velocity sedimentation analysis.     

Study of the mechanism of Corynebacterium parvum antitumour activity: Protective effect in mice submitted to sublethal doses of irradiation

Summary The antitumour activity of C. parvum against two different tumours, a lymphosarcoma grafted in XVII mice and a mammary carcinoma grafted in C₃H mice, was a radiosensitive phenomenon. A dose of X-rays as low as 100 rads was sufficient to abrogate the C. parvum-induced protection. The duration of this inhibition increased with augmentation of the X-ray dose. The stimulation of macrophage-phagocytic activity induced by C. parvum was not inhibited by a dose of 500 rads. A chronological parallelism has been demonstrated in the recovery of the C. parvum antitumour effect and the restoration of antibody responsiveness after the suppression of these two activities by 500 rads of X-rays in the case of the C₃H mice grafted with mammary carcinoma cells. No such concomitant recovery has been observed in XVII mice. In these mice, the recovery of C. parvum antitumour activity took place before the restoration of antibody responsiveness.     

Lipid-protein interactions at the erythrocyte membrane. Different influence of glucose and sorbose on membrane lipid transition

When observed over a temperature range, erythrocyte membrane lipids undergo a transition at 18–20 °C (Zimmer, G. and Shirmer, H. (1974) Biochim. Biophys. Acta 345, 314–320). This observation has prompted an investigation of the effects that substrate binding has on the transition of the red cell membrane. Glucose and sorbose were compared, since transport kinetics of these sugars still pose unresolved questions.In membranes, preloaded with glucose, the break at the transition temperature was intensified, while it was abolished or reversed in membranes preloaded with sorbose.These results were corroborated using different solubilization procedures (sonication, sodium dodecyl sulfate treatment) of the membranes, and also different techniques (viscosimetry, 90° light scattering, 1-anilino-naphthalene-8-sulfonate fluorescence).In extracted membrane lipids, viscosimetry indicated a break at transition temperature after preloading with either glucose or sorbose.Disc electrophoresis revealed a different binding pattern of the two sugars.It is suggested, that the amplification of the discontinuity in red cell membranes by glucose and the abolition or reversal of the break by sorbose are mediated by membrane protein- and/or membrane lipid-protein interaction.