On the developmental dependence between Cyanophora paradoxa and Cyanocyta korschikoffiana in symbiosis

The prokaryote Cyanocyta korschikoffiana was isolated from the eukaryote Cyanophora paradoxa. The synthesis of several thylakoid proteins in these cyanelles is influenced by light and darkness and is sensitive to cycloheximide, the inhibitor of the eukaryotic host's translation. The possibility of a direct coordination between the translations of the host and of the cyanelles is discussed.Abbreviations CHM treatment addition of cycloheximide - CPN chlorophylline - PBN phycobiline - SDS-PAGE sodium-dodecylsulphate-polyacrylamide gelelectrophoresis     

Effect of temperature on the stability and activity of crystalline ox liver nuclear and mitochondrial glutamate dehydrogenases

A study on the response of the stability and activity of crystalline ox liver nuclear and mitochondrial glutamate dehydrogenases to temperature variations has been carried out. The thermodynamic properties of the heat inactivation process and of the reaction with the substrates glutamate and α-ketoglutarate have been investigated. The heat inactivation of nuclear glutamate dehydrogenase proceeds at a faster rate than that of the mitochondrial enzyme in the temperature range 40–51 °C; the enthalpy of activation of the inactivation process is higher and the entropy is almost double, compared to the values of mitochondrial glutamate dehydrogenase. The effect of temperature on the maximal velocity shows that, with both glutamate and α-ketoglutarate, the enthalpy of activation with nuclear glutamate dehydrogenase is double and the decrease in entropy almost half of the values of the mitochondrial enzyme. The variation of the apparent K_m with temperature shows a decrease of the affinity of both enzymes for glutamate, with no major difference in the thermodynamic properties of the reaction. With α-ketoglutarate, on the other hand, the affinity of nuclear glutamate dehydrogenase decreased, whereas that of the mitochondrial enzyme increased with temperature. The process is therefore exothermic with the former enzyme, endothermic with the latter; furthermore, it occurs with a decrease in enthropy with nuclear glutamate dehydrogenase, but with a large increase with the mitochondrial enzyme. The studies on the effect of temperature on the activity were carried out in the range 20–44 °C.     

A small-scale saturator for experiments in which a high accuracy in humidity is required

Summary A saturator of small dimensions is described. Moist air with dewpoint temperatures ranging from 2°C to 30°C with a long-term stability of ±0.05°C and a maximum output of 400 1/h can be attained.Special attention is paid to the calibration procedure and to the effect of the reduction of dewpoint temperature of moist air flowing through a tube.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

R-factor-mediated suppression of the galactose-sensitive phenotype of Escherichia coli K-12 galE mutants

Plasmids S-a and Rts1 suppress the galactose-sensitive phenotype of galE mutants of Escherichia coli K-12, giving rise to both galactose-fermenting and nonfermenting strains. Fermenting strains produce normal inducible UDP-galactose epimerase. Plasmids extracted from either a fermenting or a nonfermenting strain are indistinguishable when examined by either measurements of length of relaxed circular molecules by electron microscopy or electrophoretic pattern of restriction endonuclease digestion products. The phenomenon could be explained by reversible recombination between a plasmid-borne epimerase gene and homologous chromosomal sequences.     

The enzymatic system thiosulfate: Cytochrome c oxidoreductase from photolithoautotrophically grown Rhodopseudomonas palustris

Rhodopseudomonas palustris cells, characterized by a lamellar type intracytoplasmic chromatophore membrane system after phototrophic growth, yielded a crude supernatant cell-free fraction (S-144) after ultracentrifugation which retained the contents of both the cell compartments. After thiosulfate-dependent growth, a protein system was isolated from S-144 which catalyzed the thiosulfate-linked reduction of an endogenous c-type cytochrome. — The colorless oxidoreductase protein, after purification to homogeneity, revealed a molecular weight of 93,000 and, after SDS treatment, a particle weight of 48,000. It was focused at an average pI of 5.45. Apparent K _m values for several substrates were in the M range. The electron acceptor for thiosulfate oxidation was found to be a cytochrome c from S-144. The homogeneous acceptor protein, at liquid nitrogen temperature, exhibited absorption maxima at 549.0, 518.5 and 418.0 nm, and shoulders at 525.5, 512.0 and 508.0 nm. Its molecular weight was found to be 17,000 (gel filtration) and 16,000 (SDS gel electrophoresis). It was characterized by a pI of 10.0. Its midpoint redox potential of E _m,7.0=+228 mV was determined by redox titrations and the value of +205 mV by spectrophotometric calculations.Abbreviations BSA bovine serum albumin - HiPIP high potential nonheme iron protein - IEF isoclectric focusing - SDS dodecylsulfate, sodium salt - Temed N,N,N,N-tetramethylethylenediamine     

The Chicago variant of clinical galactosemia

Summary A new variant of clinical galactosemia with two hitherto unidentified alleles on the transferase locus in one family is described. This new clinical variant of transferase has 25% of normal control activity in blood and in skin fibroblasts, and the patient accumulates galactose-1-phosphate in blood on an unrestricted galactose diet. Using starch gel electrophoresis on the hemolysate of the family members, a fast-moving transferase with mobility in between those of the normal control and of the Duarte variant is identified. This new allele is designated as (fast-moving Chicago variant). In addition, a second new allele was documented in this family by studying the instability of the transferase enzyme in hemolysates of family members at 50°C for various time intervals. This new allele is designated as (heat-labile Chicago variant). On the basis of the studies, the transferase genotype of this patients is thought to be a double heterozygote compound, /GALT^G.     

β-d-glucosidase-catalysed transfer of the glycosyl group from aryl β-d-gluco- and β-d-xylo-pyranosides to phenols

The effect of phenols on the hydrolysis of substituted phenyl β-d-gluco- and β-d-xylo-pyranosides by β-d-glucosidase from Stachybotrys atra has been investigated. Depending on the glycon part of the substrate and on the phenol substituent, the hydrolysis is either inhibited or activated. With aryl β-d-xylopyranosides, transfer of the xylosyl residue to the phenol, with the formation of new phenyl β-d-xylopyranosides, is observed. With aryl β-d-glucopyranosides, such transfer does not occur when phenols are used as acceptors, but it does occur with anilines. A two-step mechanism, in which the first step is partially reversible, is proposed to explain these observations. A qualitative analysis of the various factors determining the overall effect of the phenol is given.     

Steroid modulation of oxytocin/vasopressin receptors in the uterus

Oxytocin (OT) and V1 vasopressin (VP) receptors are present simultaneously in several tissues, including the uterus. In myometrium these receptors mediate contractility, while in endometrium they mediate the release of other uterotonic substances as endothelin (ET). In rabbit myometrium, estrogens increase, while progesterone blunts neurohypophysial hormone receptors. However, the action of sex steroids on OT and V1 VP receptors differs in terms of the ED₅₀ and maximal effect. Therefore, at parturition, only OT receptors show a dramatic rise, while V1 VP receptors do not change, suggesting a major role for OT in labor. ET is a potent stimulator of uterine activity acting through specific receptors present on myometrial cells. These receptors as well as the endometrial localization of ET are modulated by sex steroids, indicating that ET might represent a paracrine regulator of uterine activity. In humans, OT but not V1 VP receptors increase as pregnancy progresses, confirming the primary relevance of OT in timing delivery.