The effect of perinatal oestrogen treatment on the troph-hormone secreting cells of the anterior pituitary of the rat

Late effect of the perinatal administration of oestradiol dipropionate on pituitary gonadotrophs and the morphology of the LH-RH neuronal system was tested both in male and female rats. Oestrogen caused a severe reduction in the number and size of immunodetectable gonadotrophs in both sexes. By the 90th day of life, however, immunomorphology and distribution of the gonadotroph cells had became normal, and also the LH-RH system of the animals was similar to that of the intact controls. The lack of vaginal cycles indicated, however, that oestrogen might have permanently impaired higher brain centers regulating cyclic gonadotroph hormone release.     

Cellulose acetate electrophoresis of protein kinases: Detection of the active forms using various substrates

Electrophoresis on cellulose acetate strips was used to analyze protein kinases from normal rat liver. In addition to already well-characterized cAMP-dependent protein kinases type I and II and cAMP-independent casein kinases I and II, this method enabled the detection of several supplementary bands corresponding to kinases which were investigated according to their substrate specificity, activation by cAMP, and inhibition by the specific inhibitor of the catalytic subunit of cAMP-dependent protein kinases or by heparin. Using this rapid, sensitive, and resolutive electrophoretic method, different isozyme patterns could be obtained starting from minute amounts of different types of biological material.     

Neurons containing luteinizing hormone-releasing hormone in the indusium griseum of the rat

The authors detected LH--RH-containing neurons in the dorsal part of the hippocampus and in the indusium griseum of the rat. LH--RH-containing nerve fibres interconnect the organum subfornicale (OSF) and the dorsal hippocampus. Axons leaving the OSF can be traced backwards, then around the splenium of the corpus callosum, from where they run forwards in the stria longitudinalis medialis (SLM). LH--RH fibres of the SLM give axon collaterals to the cingulate cortex, then intermingle with the LH--RH system of the septum pellucidum. Following coronal transection of the SLM, it could be determined that LH--RH fibres form bidirectional connection between the septum and different regions of the hippocampus.     

The NSR1 gene encodes a protein that specifically binds nuclear localization sequences and has two RNA recognition motifs

We previously identified a protein (p67) in the yeast, Saccharomyces cerevisiae, that specifically recognizes nuclear localization sequences. We report here the partial purification of p67, and the isolation, sequencing, and disruption of the gene (NSR1) encoding this protein. p67 was purified using an affinity column conjugated with a peptide containing the histone H2B nuclear localization sequence from yeast. Using antibodies against p67 we have cloned the gene for this protein. The protein encoded by the NSR1 gene recognizes the wild-type H2B nuclear localization sequence, but does not recognize a mutant H2B sequence that is incompetent for nuclear localization in vivo. Interestingly, the NSR1 protein has two RNA recognition motifs, as well as an acidic NH2 terminus containing a series of serine clusters, and a basic COOH terminus containing arg-gly repeats. We have confirmed the nuclear localization of p67 by immunofluorescence and found that a restricted portion of the nucleus is highlighted. We have also shown that NSR1 (p67) is required for normal cell growth.     

Effects of isoflurane, halothane, and enflurane on myocardial flow and energy stores in the perfused rat heart

The effect of three volatile anesthetics (halothane, enflurane, and isoflurane) on coronary flow and metabolic state of isolated rat hearts was studied. These anesthetics are coronary dilators and their effects are dose dependent. At 2 MAC (minimum alveolar concentration), isoflurane, enflurane, and halothane increase coronary flow by 114 +/- 5.9, 93 +/- 6.1, and 77 +/- 6.4%, respectively (p less than 0.001). At these concentrations, they also have a modest but significant metabolic effect causing a 30% reduction in myocardial ATP and phosphocreatine levels, with no significant modification in ADP and AMP concentrations. Energy charge and lactate/pyruvate ratio were also unaffected by these anesthetics. The vascular and metabolic effects were reversible within 2 and 30 min, respectively. Perfusion of the hearts with a Krebs-Henseleit solution without Pi did not interfere with the vascular and the metabolic effect of the anesthetics; however, in this case, ATP and phosphocreatine concentration did not return to control levels after their discontinuation despite full recovery of the vascular effect. These data suggest that the volatile anesthetics have direct coronary vascular and myocardial metabolic effects and that these effects occur independently.     

Synergistic Regulation of Cytosolic Ca2+ Concentration in Mouse Astrocytes by NK1 Tachykinin and Adenosine Agonists

The effects on cytosolic Ca2+ concentration of 2-chloroadenosine and [L-Pro9]-substance P, a selective agonist of NK1 receptors, were investigated on astrocytes from embryonic mice in primary culture. Cells responded to [L-Pro9]-substance P with a transitory increase in cytosolic Ca2+ which was of shorter duration when external Ca2+ was removed. A transient response to 2-chloroadenosine alone occurred. When simultaneously applied, [L-Pro9]-substance P and 2-chloroadenosine evoked a prolonged elevation of cytosolic Ca2+ (up to 30 min). This phenomenon was dependent on the presence of extracellular Ca2+, but insensitive to dihydropyridines, La3+, and Co2+, excluding the implication of voltage-operated Ca2+ channels. Arachidonic acid also induced a sustained elevation of cytosolic Ca2+, but did not increase further the response evoked by [L-Pro9]-substance P and 2-chloroadenosine. The activation of protein kinase C by a diacylglycerol analogue mimicked the effect of [L-Pro9]-substance P in potentiating the 2-chloroadenosine-evoked response. Like 2-chloroadenosine, pinacidil, which hyperpolarizes the cells by opening K+ channels, prolonged the elevation of cytosolic Ca2+ concentration induced by [L-Pro9]-substance P. Conversely, depolarization with 50 mM KCl canceled the effects of either pinacidil or 2-chloroadenosine applied with [L-Pro9]-substance P. Pertussis toxin pretreatment suppressed all the effects induced by 2-chloroadenosine.     

Steroid glucuronides: Human circulatory levels and formation by LNCaP cells

We studied the relationship between circulating androsterone glucuronide, androstane-3,17β-diol glucuronide and androstane-3β,17β-diol glucuronide concentrations and adrenal as well as testicular C-19 steroids in men. Among the three 5-reduced steroid glucuronides, androsterone glucuronide is the predominant C-19 steroid measured in plasma and its levels are markedly elevated compared to those of the non-conjugated steroid. The marked rise in testosterone during puberty was strongly correlated with the increase in both androsterone glucuronide and androstane-3,17β-diol glucuronide, thus suggesting that testicular C-19 steroids are the main precursors of the steroid glucuronides. We also found that the presence of testicular androgen in plasma contributes to approx. 70% of plasma androsterone glucuronide and androstane-3,17β-diol glucuronide. Our data suggest that the adrenal C-19 steroids remaining in circulation after castration in men are converted into potent androgen which are then glucuronidated by UDP-glucuronyltransferase. We also demonstrated that the human prostate cell line LNCaP is capable of converting to a large extent androstenedione into androsterone glucuronide. Our data further confirm that glucuronidation is a major pathway of steroid metabolism in steroid target tissues.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Effect of N,N-Dicyclohexylcarbodiimide on Acetylcholine Release from Torpedo Synaptosomes and Proteoliposomes Reconstituted with the Proteolipid Mediatophore

The mediatophore is a presynaptic membrane protein that has been shown to translocate acetylcholine (ACh) under calcium stimulation when reconstituted into artificial membranes. The mediatophore subunit, a 15-kDa proteolipid, presents a very high sequence homology with the N,N'-dicyclohexylcarbodiimide (DCCD)-binding proteolipid subunit of the vacuolar-type H(+)-ATPase. This prompted us to study the effect of DCCD, a potent blocker of proton translocation, on calcium-dependent ACh release. The present work shows that DCCD has no effect on ACh translocation either from Torpedo synaptosomes or from proteoliposomes reconstituted with purified mediatophore. However, using [14C]DCCD, we were able to demonstrate that the drug does bind to the 15-kDa proteolipid subunit of the mediatophore. These results suggest that although the 15-kDa proteolipid subunits of the mediatophore and the vacuolar H(+)-ATPase may be identical, different domains of these proteins are involved in proton translocation and calcium-dependent ACh release and that the two proteins have a different membrane organization.