A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Procedures for the production and separation of H and M antigens in histoplasmin: Chemical and serological properties of the isolated products

Two strains of Histoplasma capsulatum were required to prepare maximum yields of H and of M antigen from histoplasmin. The antigens were separated and partially purified by a series of procedures yielding an overall recovery of 70 to 90% of the individual antigens. Stable products suitable for use as reference products were obtained when the final purification step employed DEAE-cellulose with phosphate buffer elution at increasing molarity and decreasing pH. A final step of purification of each antigen with slab acrylamide gel electrophoresis gave products which were highly reactive and specific in a variety of serological tests with sera from persons with proven cases of histoplasmosis and with natural infections of heterologous deep mycoses. These antigens were maximally active at concentrations of 2 to 16 g protein in the complement fixation, capillary precipitin, microimmunodiffusion, or immunoelectrophoresis tests; 0.5 g gave a maximum delayed cutaneous hypersensitivity reaction in homologously infected animals and caused no appreciable reaction in control animals. Although these antigens appeared to be specific when tested with sera from persons with natural infections, the M and H antigens demonstrated the presence of an additional antigen reacting with sera of rabbits immunized with cell membrane and cell particulate fractions of Blastomyces dermatitidis. After purification by electrophoresis, both the H and M antigens of some preparations showed some decomposition and loss of reactivity after storage at 5 C for more than six months. The overall results suggest that the purified H and M antigens of Heiner (12) have multiple serological reactivity and may function in precipitin reactions, complementfixing reactions, hemagglutination of formalin-fixed goose red blood cells, and as antigens for delayed cutaneous tests.     

Rabbit liver tRNA1Val:I. Primary structure and unusual codon recognition.

The major valine acceptor tRNA1Val from rabbit liver was purified and its nucleotide sequence determined by in vitro [32P] - labeling with T4 phage induced polynucleotide kinase and finger-printing techniques. Its primary structure was found to be identical with the major valine tRNA from mouse myeloma cells. According to the wobble hypothesis this tRNA, which exclusively has an IAC anticodon, should decode the valine codons GUU, GUC and GUA only. However, this tRNA recognizes all four valine codons with a surprising preference for GUG. It is unknown whether this is due to the lack of A37 modification next to the 3' end of the anticodon IAC. The nature of the inosine-guanosine interaction remains to be clarified.     

Freeze-fracturing in ultrahigh vacuum at -196 degrees C

Conventional freeze-etching is carried out in a vacuum of approximately 10(-6) torr and at a specimen temperature of -100 degrees C. The relatively poor topographic resolution of most freeze-etch replicas, and the lack of complementarity of morphological details in double replicas have been thought to be caused by structural distortions during fracturing, and radiation damage during replication. Both phenomena can be reduced by lowering the specimen temperature. To prevent condensation of residual gases (especially H2O) on the fracture faces at lower specimen temperature, an improved vacuum is required. Therefore, an ultrahigh vacuum freeze-fracture apparatus has been developed which allows fracturing and Pt/C-shadowing of specimens at -196 degrees C while maintaining a vacuum of 10(-9) torr. It consists of a modified Balzers BA 350 ultrahigh vacuum (UHV) unit, equipped with an airlock which enables the input of nonhoar-frosted specimens directly into the evacuated bell jar. A comparison of the paracrystalline plasmalemma structure in yeast cells portrayed by the conventional technique and by UHV-freeze-fracturing at -196 degrees C shows the improved topographic resolution which has been achieved with the new technique. The improvement is explained by less structural distortions during fracturing at lower temperatures. The particles of the paracrystalline regions on the P face are more regularly arranged and exhibit a craterlike substructure which corresponds with a ringlike depression in the E face. The optical diffraction patterns of these paracrystalline regions demonstrate the improvement of the structural record by showing well-defined third- and fourth-order spots.     

Medical and surgical approach to laryngeal air sacculitis in a baboon caused by Pasteurella multocida.

Air sacculitis was diagnosed in a chronically chaired baboon, Papio anubis. Pasteurella multocida was repeatedly isolated from the air sac for a period of 1 year. The condition was characterized by the continuous accumulation of either mucoserous or purulent fluid. Biopsies of the air sac taken during the course of the disease initially revealed goblet cell hyperplasia. Later a subepithalial mononuclear or polymorphonuclear infiltrate and necrosis was the predominate finding. Medical therapy was only intermittently successful and consisted of frequent drainage and antibiotics administered locally and intravenously. The condition was resolved after surgical resection of the air sac lining membrane.     

Studies on dehydro-l-ascorbic acid 2-arylhydrazone 3-oximes: Conversion into substituted triazoles and isoxazolines

l-threo-2,3-Hexodiulosono-1,4-lactone 2-(arylhydrazones) (2) were prepared by condensation of dehydro-l-ascorbic acid with various arylhydrazines. Reaction of 2 with hydroxylamine gave the 2-(arylhydrazone) 3-oximes (3). On boiling with acetic anhydride, 3 gave 2-aryl-4-(2,3-di-O-acetyl-l-threo-glycerol-l-yl)-1,2,3-triazole-5-carboxylic acid 5,4¹-lactones (4). On treatment of 4 with liquid ammonia, 2-aryl-4-(l-threo-glycerol-l-yl)-1,2,3-triazole-5-carboxamides (5) were obtained. Acetylation of 5 with acetic anhydride-pyridine gave the triacetates, and vigorous acetylation with boiling acetic anhydride gave the tetraacetyl derivatives. Periodate oxidation of 5 gave the 2-aryl-4-formyl-1,2,3-triazole-5-carboxamides (8), and, on reduction, 8 gave the 2-aryl-4-(hydroxymethyl)-1,2,3-triazole-5-carboxamides, characterized as the monoacetates and diacetates. Controlled reaction of 2 with sodium hydroxide, followed by neutralization, gave 3-(l-threo-glycerol-l-yl)-4,5-isoxazolinedione 4-(arylhydrazones), characterized by their triacetates. Reaction of 2 with HBr-HOAc gave 5-O-acetyl-6-bromo-6-deoxy-l-threo-2,3-hexodiulosono-1,4-lactone 2-(arylhydrazones); these were converted into 4-(2-O-acetyl-3-bromo-3-deoxy-l-threo-glycerol-l-yl)-2-aryl-1,2,3-triazole-5-carboxylic acid 5,4¹-lactones on treatment with acetic anhydride-pyridine.     

Effect of food-deprivation on rat pancreatic islet cells

Somatostatin, insulin and glucagon concentrations in rat pancreas were measured following various intervals of food-deprivation. Tissue concentrations, as measured by radioimmunoassay, were correlated with A-, B-, and D-cell number and size using a scanning integrating image analyzer (Quantimet 720). Alterations in total islet hormone content were not correlated to changes in size or distribution of cells. This implies that changes in tissue content reflect changes in turnover of peptides rather than changes in cell size or number.     

Platelet-derived growth factor isoforms AA, AB, and BB differentially activate poly r(I):r(C)-induced genes in human fibroblast FS4 cells.

Polyribocytidylic-polyriboinosinic acid [poly r(I):r(C)]-inducible genes were isolated by a differential screening procedure from a human fibroblast cell (FS-4) cDNA bank. Among yet unidentified genes (gene 274), one codes for a protein with multiple finger motifs and has previously been detected in endothelial cells after tumor necrosis factor-alpha (TNF-alpha) treatment (A20; Opipari et al., 1990), the second one codes for a variant of the I kappa B family (Haskill et al., 1991), and a third one for the Ca2+ ATPase (isoform 1). Platelet-derived growth factor (PDGF) isoforms (AA, AB, and BB) stimulated the expression of these immediate-early genes. But the extent of the respective induction correlated neither with the number of the two receptors alpha or beta nor with the level of PDGF-stimulated receptor autophosphorylation on tyrosine. Although alpha-receptors were less abundant than beta-receptors (12,500 binding sites were estimated for PDGF-AA, KD 0.03 nM; 20,000 for PDGF-AB, KD 0.03 nM; 35,000 for PDGF-BB KD 0.16 nM) and tyrosine phosphorylation induced by PDGF-AA was significantly less than that evoked by PDGF-BB, some of the investigated genes were more strongly induced by PDGF-AA. We discuss how the differences in the biological potency of the PDGF isoforms may reside in different functions of the two receptors by activation of alternative signaling pathways.     

Suicide inhibition of canine myocardial cytosolic calcium-independent phospholipase A2. Mechanism-based discrimination between calcium-dependent and -independent phospholipases A2

The majority of phospholipase A2 activity in myocardium is calcium-independent and selective for hydrolysis of plasmalogen substrate (Wolf, R. A., and Gross, R. W. (1985) J. Biol. Chem. 260, 7295-7303; Hazen, S. L., Stuppy, R. J., and Gross, R. W. (1990) J. Biol. Chem. 265, 10622-10630). Accordingly, identification of an inhibitor which selectively targets calcium-independent phospholipases A2 would facilitate elucidation of the biologic significance of this class of intracellular phospholipases. We now report that the haloenol lactone, (E)-6-(bromomethylene)tetrahydro-3-(1-naphthalenyl)-2H-pyran-2-one (Compound 1), is a potent, irreversible, mechanism-based inhibitor of myocardial calcium-independent phospholipase A2 which is greater than 1000-fold specific for inhibition of myocardial calcium-independent phospholipase A2 in comparisons with multiple calcium-dependent phospholipases A2. Mechanism-based inhibition of myocardial cytosolic calcium-independent phospholipase A2 by Compound 1 was established by demonstrating: 1) time-dependent irreversible inactivation; 2) covalent binding of [3H]Compound 1 to the purified phospholipase A2; 3) ablation of covalent binding of [3H]Compound 1 after chemical inactivation of phospholipase A2 enzymic activity; 4) identical inhibition of myocardial phospholipase A2 by Compound 1 in the absence or presence of nucleophilic scavengers; 5) Compound 1 is a substrate for myocardial calcium-independent phospholipase A2 resulting in the generation of the electrophilic alpha-bromomethyl ketone; 6) phospholipase A2 inhibition requires the in situ generation of the reactive electrophile (i.e. neither the alpha-bromomethyl ketone nor the diproteoenol lactone analog are inhibitory); and 7) concomitant attenuation of the inhibitory potency and the extent of covalent adduct formation in the presence of saturating substrate. Collectively, these results demonstrate that the haloenol lactone, Compound 1, is a substrate for, covalently binds to, and irreversibly inhibits canine myocardial cytosolic calcium-independent phospholipase A2.