Controlling vitrification of petunia in vitro

Summary Nodal segments from in vitro culturedPetunia hybrida were grown under varying cultural conditions. The origin of nodal explants influenced vitrification. Basal segments formed a higher percentage of vitreous shoots than did the upper nodes. A method was developed for including polyethylene glycol with Gelrite to obtain gelled media of varying water potentials. Media water potential from −0.31 to −1.2 MPa had no effect on controlling the level of vitrification. Gelrite promoted vitrification but GIBCO agar, alone or in combination with Gelrite, reduced its occurrence. Lowering media NH₄ content reduced vitrification, whereas sealing culture vessels with parafilm increased it. As it is now possible to control normal and vitreous plant development inPetunia, this can be used as a model system for studying the physiology and biochemistry of this developmental abnormality.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Primary Structure of Cytochrome b(5) from Cauliflower (Brassica oleracea L.) Deduced from Peptide and cDNA Sequences

Cytochrome b₅ is a microsomal protein that functions as an intermediate electron donor in fatty acid desaturation and other oxidation/reduction reactions. cDNA clones were isolated from cauliflower (Brassica oleracea L.) by using oligonucleotides based on the partial amino acid sequence of the protein. The deduced amino acid sequence of the polypeptide exhibited approximately 30% sequence identity with the homologous protein from vertebrates.     

Gibberellin Is Required for Flowering in Arabidopsis thaliana under Short Days

Mutants of Arabidopsis thaliana deficient in gibberellin synthesis (ga1-3 and ga1-6), and a gibberellin-insensitive mutant (gai) were compared to the wild-type (WT) Landsberg erecta line for flowering time and leaf number when grown in either short days (SD) or continuous light (CL). The ga1-3 mutant, which is severely defective in ent-kaurene synthesis because it lacks most of the GA1 gene, never flowered in SD unless treated with exogenous gibberellin. After a prolonged period of vegetative growth, this mutant eventually underwent senescence without having produced flower buds. The gai mutant and the “leaky” ga1-6 mutant did flower in SD, but took somewhat longer than WT. All the mutants flowered readily in CL, although the ga1-3 mutant showed some delay. Unlike WT and ga1-3, the gai mutant failed to respond to gibberellin treatment by accelerating flowering in SD. A cold treatment promoted flowering in the WT and gai, but failed to induce flowering in ga1-3. From these results, it appears that gibberellin normally plays a role in initiating flowering of Arabidopsis.     

Ultrastructural comparison of incompatible and compatible interactions in the barley powdery mildew disease

Summary In the powdery mildew disease of barley,Erysiphe graminis f. sp.hordei forms an intimate relationship with compatible hosts, in which haustoria form in epidermal cells with no obvious detrimental effects on the host until late in the infection sequence. In incompatible interactions, by contrast, the deposition of papillae and localized host cell death have been correlated with the cessation of growth byE. g. hordei. With the advent of improved, low temperature methods of sample preparation, we felt that it was useful to reevaluate the structural details of interactions between barley andE. g. hordei by transmission electron microscopy. The haustoria that develop in susceptible barley lines appear highly metabolically active based on the occurrrence of abundant endoplasmic reticulum, Golgi-like cisternae, and vesicles. In comparison, haustoria found in the resistant barley line exhibited varying signs of degradation. A striking clearing of the matrix and loss of cristae were typical early changes in the haustorial mitochondria in incompatible interactions. The absence of distinct endoplasmic reticulum and Golgi-like cisternae, the formation of vacuoles, and the occurrence of a distended sheath were characteristic of intermediate stages of haustorial degeneration. At more advanced stages of degeneration, haustoria were dominated by large vacuoles containing membrane fragments. This process of degeneration was not observed in haustoria ofE. g. hordei developing in the susceptible barley line.Abbreviations b endoplasmic reticulum extension, blebbing - er endoplasmic reticulum - f fibrillar material - g Golgi-like structure - h haustorium - hb haustorial body - hcw haustorial cell wall - hcy haustorial cytoplasm - hf haustorial finger - hocw host cell wall - hocy host cytoplasm - 1 lipid-like droplet - m mitochondrion - mt microtubule - mve multivesicular body - n nucleus - p papilla - ph penetration site of an infection peg - pl plasma membrane - s sheath - sm extrahaustorial membrane - v vacuole - ve vesicle     

Genetic differentiation ofDrosophila melanogaster populations as assessed by two-dimensional electrophoresis

Seven populations ofDrosophila melanogaster, representing a worldwide distribution, were compared using two-dimensional protein gel electrophoresis. A total of 611 protein spots was scored, which probably represent a sample of over 500 loci that were surveyed. Of the protein spots scored, 521 spots were found to be invariant, but another 90 spots were found to be variable among the populations. Of these variable protein spots, 12 were found to be present in only one population. All the populations, except one, had at least one protein spot restricted to itself. However, the Japanese population had by far the most, with five protein spots restricted to this one population, which has been observed in previous studies of private alleles in oriental populations. The mean genetic similarity (F) found among the seven populations was 0.965, with a range of between 0.956 and 0.977. This is similar to previous reports of lower variation found in population genetic surveys using two-dimensional electrophoresis. It was found that the historical relationships among these populations was somewhat congruent with the geographic distribution of the populations, but as in previous studies, it was not exactly coincident.     

HOST EFFECTS ON FERTILITY AND REPRODUCTIVE SUCCESS OF DENDROCTONUS PONDEROSAE HOPKINS (COLEOPTERA: SCOLYTIDAE)

Mountain pine beetles from lodgepole and limber pine in western Canada were crossbred. We compared data about reproductive success and fecundity of parents as well as development, mortality, and fertility of their progeny to determine whether there was reproductive isolation among beetle populations in these hosts. Three factors, directly or indirectly related to the host, influenced reproductive performance of parents (reproductive success, egg gallery length, fecundity, and number of eggs laid per centimeter of gallery) as well as the mortality, dry weight, and fat content of the progeny: (1) the host species in which progeny were reared, (2) the host species in which the female parent was reared, and (3) whether both parents originated from the same or different host species. Limber pine appears to be a better host for Dendroctonus ponderosae reproduction and survival than lodgepole pine. Nonetheless, beetles reared from lodgepole and limber pine can reproduce in either host and will mate with each other. Progeny of all crosses were fertile. Thus, there is no apparent barrier to prevent beetles from the two host species from interbreeding in the field.