Chilling-sensitive mutants of arabidopsis

Twenty-one mutants ofArabidopsis thaliana were isolated that developed chlorosis or necrosis upon incubation at low temperature (10°C to 15°C). Crosses among mutants in different phenotypic classes showed that mutants in three of four classes were found in a small number of loci. This article is reproduced fromWeeds World, vol. 1. For electronic access toWeeds World, see PMBR 12(4):302–303.     

Autoradiographic localization of ornithine decarboxylase in mouse kidney by use of radiolabeled α-difluoromethylornithine

Summary Ornithine decarboxylase, a key enzyme in polyamine biosynthesis and cell growth, has been localized in mouse kidney by autoradiography after administration of radiolabeled -difluoromethylornithine. This drug is an enzyme-activated irreversible inhibitor of ornithine decarboxylase and forms a covalent bond with the enzyme. It was found that ornithine decarboxylase is present in all cell types studied but that the highest content occurs in the proximal convoluted tubules followed by the distal convoluted tubules and the collecting tubules. The majority of the enzyme is located in the cytoplasm but about 10–15% is present in the nuclei (often associated with nucleolus-like components) of the cells of the proximal and distal convoluted tubules. The labeled ornithine decarboxylase was lost rapidly from both nucleus and cytoplasm of all the cell types examined, and labeling by radioactive -difluoromethylornithine was greatly reduced if the mice were pretreated for 5 h with cycloheximide to block protein synthesis. These results indicate that ornithine decarboxylase turns over rapidly in all of the cells.     

Mutants of Escherichia coli defective in the degradation of guanosine 5''-triphosphate, 3''-diphosphate (pppGpp).

Summary A new class of mutants of E. coli exhibiting altered metabolism of ppGpp and pppGpp has been isolated, and mapped at a locus designated gpp, near min 83 on the genetic map. These mutants accumulate elevated levels of pppGpp during amino acid starvation or carbon source downshift, and exhibit a reduced rate of pppGpp degradation in vivo. The in vitro evidence suggests that the gpp mutants are defective in a 5-nucleotidase, which specifically hydrolyzes pppGpp to ppGpp. Certain combinations of gpp and spoT mutations are inviable. A gpp spoT double mutant, constructed by employing a leaky spoT mutation, was found to have a slower rate of pppGpp degradation than the gpp mutant alone. This result indicates that spoT also participates in pppGpp degradation. The inviability of certain gpp spoT combinations is attributed to the inability of the double mutants to degrade pppGpp. This is supported by the observation that selection for increased growth rate on the double mutant results in the recovery of relA mutations. Various effects of the gpp mutation upon the pppGpp and ppGpp pools provide additional support for a scheme in which pppGpp is the major precursor of ppGpp.     

Cloning the trpR gene.

Summary In Escherichia coli, the structural gene for purine nucleoside phosphorylase, deoD, is subject to insertional inactivation by prophage . From one such secondary site lysogen, strain SP265, one may isolate deletions that remove all or part of the trpR gene and other genes in the deo-thr sector of the E. coli chromosome. Specialized transducing phages harboring serB ⁺ and trpR ⁺ were liberated following induction of SP265. All such phages were N-defective, bio-type pseudolysogens whose DNA persisted in the form of plasmids. A collection of transducing phages, differing in their complement of bacterial DNA, was used to locate cleavage sites for bamHI, SalI, and PvuI within the deoD-trpR region of the E. coli genome. The trpR gene lies within a specific 950 base pair BamHI-PvuI segment.A 1250 base pair BamHI fragment carrying a functional trpR gene was cloned into the amplifiable plasmid pBR322. A single SalI site in this fragment was shown to lie within the trpR gene.In two situations where increased gene dosage might generate elevated amounts of Trp repressor (N-defective trpR ⁺ pseudolysogens and strains harboring pBR322 trpR ⁺ plasmids) neither tryptophan auxotrophy, enhanced sensitivity to DL-5-methyltryptophan, nor super repression of the tryptophan biosynthetic enzymes was observed.Journal Paper No. 7426 of the Purdue University Agricultural Experiment Station     

Mutations at the Arabidopsis CHM locus promote rearrangements of the mitochondrial genome.

Nuclear recessive mutations at the chloroplast mutator (CHM) locus of Arabidopsis produce a variegated phenotype that is inherited in a non-Mendelian fashion. Molecular analysis of the cytoplasmic genomes of variegated plants from two independent chm mutant lines, using specific chloroplast and mitochondrial probes, showed that the chm mutations reproducibly induce the appearance of specific new restriction fragments in the mitochondrial genome. The presence of these restriction fragments cosegregated with the variegated phenotype in the progeny of crosses between mutant and wild-type plants. Sequence analysis of one of the new restriction fragments found in the variegated plants suggested that it was the product of a rearrangement event involving regions of the mitochondrial genome. Thus, it appears that the CHM locus may encode a protein involved in the control of specific mitochondrial DNA reorganization events.     

Cloning, nucleotide sequence, and characterization of mtr, the structural gene for a tryptophan-specific permease of Escherichia coli K-12.

The mtr gene of Escherichia coli K-12 encodes an L-tryptophan-specific permease. This gene was originally identified through the isolation of mutations in the 69-min region of the chromosome, closely linked to argG. Cells with lesions in mtr display a phenotype of 5-methyltryptophan resistance. The mtr gene was cloned by using the mini-Mu system. The amino acid sequence of Mtr (414 codons), deduced by DNA sequence analysis, was found to be 33% identical to that of another single-component transport protein, the tyrosine-specific permease, TyrP. The hydropathy plots of the two permeases were similar. Possible operator sites for the tyrosine and tryptophan repressors are situated within the region of DNA that is likely to be the mtr promoter.     

Controlling vitrification of petunia in vitro

Summary Nodal segments from in vitro culturedPetunia hybrida were grown under varying cultural conditions. The origin of nodal explants influenced vitrification. Basal segments formed a higher percentage of vitreous shoots than did the upper nodes. A method was developed for including polyethylene glycol with Gelrite to obtain gelled media of varying water potentials. Media water potential from −0.31 to −1.2 MPa had no effect on controlling the level of vitrification. Gelrite promoted vitrification but GIBCO agar, alone or in combination with Gelrite, reduced its occurrence. Lowering media NH₄ content reduced vitrification, whereas sealing culture vessels with parafilm increased it. As it is now possible to control normal and vitreous plant development inPetunia, this can be used as a model system for studying the physiology and biochemistry of this developmental abnormality.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër