Common variants of xeroderma pigmentosum genes and prostate cancer risk

The genetic basis of prostate cancer (PC) is complex and appears to involve multiple susceptibility genes. A number of studies have evaluated a possible correlation between several NER gene polymorphisms and PC risk, but most of them evaluated only single SNPs among XP genes and the results remain inconsistent. Out of 94 SNPs located in seven XP genes (XPA–XPG) a total of 15 SNPs were assayed in 720 unselected patients with PC and compared to 1121 healthy adults. An increased risk of disease was associated with the XPD SNP, rs1799793 (Asp312Asn) AG genotype (OR = 2.60; p < 0.001) and with the AA genotype (OR = 531; p < 0.0001) compared to the control population. Haplotype analysis of XPD revealed one protective haplotype and four associated with an increased disease risk, which showed that the A allele (XPD rs1799793) appeared to drive the main effect on promoting prostate cancer risk. Polymorphism in XPD gene appears to be associated with the risk of prostate cancer.     

Predictive Tools for Severe Dengue Conforming to World Health Organization 2009 Criteria

Background

Dengue causes 50 million infections per year, posing a large disease and economic burden in tropical and subtropical regions. Only a proportion of dengue cases require hospitalization, and predictive tools to triage dengue patients at greater risk of complications may optimize usage of limited healthcare resources. For severe dengue (SD), proposed by the World Health Organization (WHO) 2009 dengue guidelines, predictive tools are lacking.

Methods

We undertook a retrospective study of adult dengue patients in Tan Tock Seng Hospital, Singapore, from 2006 to 2008. Demographic, clinical and laboratory variables at presentation from dengue polymerase chain reaction-positive and serology-positive patients were used to predict the development of SD after hospitalization using generalized linear models (GLMs).

Principal findings

Predictive tools compatible with well-resourced and resource-limited settings – not requiring laboratory measurements – performed acceptably with optimism-corrected specificities of 29% and 27% respectively for 90% sensitivity. Higher risk of severe dengue (SD) was associated with female gender, lower than normal hematocrit level, abdominal distension, vomiting and fever on admission. Lower risk of SD was associated with more years of age (in a cohort with an interquartile range of 27–47 years of age), leucopenia and fever duration on admission. Among the warning signs proposed by WHO 2009, we found support for abdominal pain or tenderness and vomiting as predictors of combined forms of SD.

Conclusions

The application of these predictive tools in the clinical setting may reduce unnecessary admissions by 19% allowing the allocation of scarce public health resources to patients according to the severity of outcomes.     

Watching Every Step of the Way: Junín Virus Attenuation Markers in the Vaccine Lineage

The Arenaviridae family includes several hemorrhagic fever viruses which are important emerging pathogens. Junín virus, a member of this family, is the etiological agent of Argentine Hemorrhagic Fever (AHF). A collaboration between the Governments of Argentina and the USA rendered the attenuated Junín virus vaccine strain Candid#1. Arenaviruses are enveloped viruses with genomes consisting of two single-stranded RNA species (L and S), each carrying two coding regions separated by a stably structured, non-coding intergenic region. Molecular characterization of the vaccine strain and of its more virulent ancestors, XJ13 (prototype) and XJ#44, allows a systematic approach for the discovery of key elements in virulence attenuation. We show comparisons of sequence information for the S RNA of the strains XJ13, XJ#44 and Candid#1 of Junín virus, along with other strains from the vaccine lineage and a set of Junín virus field strains collected at the AHF endemic area. Comparisons of nucleotide and amino acid sequences revealed different point mutations which might be linked to the attenuated phenotype. The majority of changes are consistent with a progressive attenuation of virulence between XJ13, XJ#44 and Candid#1. We propose that changes found in genomic regions with low natural variation frequencies are more likely to be associated with the virulence attenuation process. We partially sequenced field strains to analyze the genomic variability naturally occurring for Junín virus. This information, together with the sequence analysis of strains with intermediate virulence, will serve as a starting point to study the molecular bases for viral attenuation.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Accumulated bending energy elicits neutral sphingomyelinase activity in human red blood cells

We propose that accumulated membrane bending energy elicits a neutral sphingomyelinase (SMase) activity in human erythrocytes. Membrane bending was achieved by osmotic or chemical processes, and SMase activity was assessed by quantitative thin-layer chromatography, high-performance liquid chromatography, and electrospray ionization-mass spectrometry. The activity induced by hypotonic stress in erythrocyte membranes had the pH dependence, ion dependence, and inhibitor sensitivity of mammalian neutral SMases. The activity caused a decrease in SM contents, with a minimum at 6 min after onset of the hypotonic conditions, and then the SM contents were recovered. We also elicited SMase activity by adding lysophosphatidylcholine externally or by generating it with phospholipase A(2). The same effect was observed upon addition of chlorpromazine or sodium deoxycholate at concentrations below the critical micellar concentration, and even under hypertonic conditions. A unifying factor of the various agents that elicit this SMase activity is the accumulated membrane bending energy. Both hypo-and hypertonic conditions impose an increased curvature, whereas the addition of surfactants or phospholipase A(2) activation increases the outer monolayer area, thus leading to an increased bending energy. The fact that this latent SMase activity is tightly coupled to the membrane bending properties suggests that it may be related to the general phenomenon of stress-induced ceramide synthesis and apoptosis.     

Plasma anti-Müllerian hormone as a biomarker for bovine granulosa-theca cell tumors: Comparison with immunoreactive inhibin and ovarian steroid concentrations

Granulosa-theca cell tumors (GTCTs) are the most frequently reported ovarian tumors in cattle. Clinically, GTCTs could be confused with other ovarian abnormalities; therefore, the only definitive diagnosis for such tumors is histopathology of a biopsy from the affected ovary. However, this is an invasive technique and unsuitable for farm conditions. As a result, the key aim of this study was to evaluate the diagnostic value of anti-Müllerian hormone (AMH), a glycoprotein hormone that is synthesized exclusively by ovarian granulosa cells, as a sensitive noninvasive biomarker for diagnosing GTCTs in cattle. To achieve this aim, we conducted two experiments. In experiment 1, four clinically healthy Japanese Black cows had blood samples taken daily over one estrous cycle to characterize their AMH profiles throughout the estrous cycle. Additionally, single blood samples were collected from 21 cyclic cows to clarify the physiological range of AMH. In experiment 2, cows with histologically confirmed GTCT (GTCT group, n = 9) and cows affected with cystic ovarian disease (COD group, n = 8) had one blood sample taken before extraction of the tumorous ovary or therapeutic treatment for the COD. Blood samples (n = 105) from cyclic cows (n = 25) in experiment 1 were assigned as a physiologically cyclic group (PC group). Plasma AMH, immunoreactive inhibin (ir-INH), estradiol-17β (E₂), testosterone (T), and progesterone (P₄) concentrations were assayed in all samples. In experiment 1, the mean plasma AMH concentration was 0.09 ± 0.003 ng/mL and did not show substantial fluctuation throughout the estrous cycle. In experiment 2, plasma AMH, ir-INH, and E₂ concentrations were significantly elevated in the GTCT group in comparison with the PC group; among these parameters, only the AMH concentrations were significantly higher in the GTCT group than in the COD group. The area under the receiver operating characteristic curve of AMH for diagnosis of GTCT was 0.99 and was significantly higher than that of ir-INH (P < 0.001) and E₂ (P < 0.01). Moreover, the AMH at a cutoff point of ≥0.36 ng/mL had the highest diagnostic accuracy (99.2%), sensitivity (100%), and specificity (99.1%) compared with the other tested parameters. In conclusion, plasma AMH concentration is probably a more reliable and sensitive biomarker for bovine GTCTs than the concentrations of ir-INH or ovarian steroids.     

Role of Tom5 in maintaining the structural stability of the TOM complex of mitochondria

Transport of nuclear encoded proteins into mitochondria is mediated by multisubunit translocation machineries in the outer and inner membranes of mitochondria. The TOM complex contains receptor and pore components that facilitate the recognition of preproteins and their transfer through the outer membrane. In addition, the complex contains a set of small proteins. Tom7 and Tom6 have been found in Neurospora and yeast, Tom5 has been found so far only in the latter organism. In the present study, we identified Neurospora Tom5 and analyzed its function in comparison to yeast Tom5, which has been proposed to play a role as a receptor-like component. Neurospora Tom5 crosses the outer membrane with its carboxyl terminus facing the intermembrane space like the other small Tom components. The temperature-sensitive growth phenotype of the yeast TOM5 deletion was rescued by overexpression of Neurospora Tom5. On the other hand, Neurospora cells deficient in tom5 did not exhibit any defect in growth. The structural stability of TOM complexes from cells devoid of Tom5 was significantly altered in yeast but not in Neurospora. The efficiency of protein import in Neurospora mitochondria was not affected by deletion of tom5, whereas in yeast it was reduced as compared with wild type. We conclude that the main role of Tom5, rather than being a receptor, is maintaining the structural integrity of the TOM complex.     

Acceptance of low-saponin lines of alfalfa with varied phenolic concentrations by pea aphid (Homoptera: Aphididae)

This research aims to examine the effect of phenolics on pea aphid (Acyrthosiphon pisum) (Homoptera: Aphididae) development and feeding behaviour, on leaves of selected low-saponin lines of Radius alfalfa (Medicago sativa). There was a slight, negative correlation (Spearman rank correlation r _s = −0.80) between concentrations of saponins and phenols. Lines with higher concentrations of saponins had less phenolics. Levels of phenolics in low-saponin lines of alfalfa cv. Radius were related to their acceptance by the pea aphid. Our data revealed an inverse relationship between level of phenolics and the aphid abundance and its biology on studied alfalfa lines. Larval development of the pea aphid was longer, reproduction period was shorter, and the fecundity was lower on low-saponin lines with higher level of phenolics. There were observed some tendencies in the pea aphid feeding behaviour on these lines: prolonging the probing of the peripheral tissues (epidermis and mesophyll) and shortening the period of phloem sap ingestion. The better hosts for the pea aphid were low-saponin lines with low levels of phenolic compounds.