Rapid method to obtain high quality nuclear and chromosome images directly from living cells in the Characeae

This study focused on a method based on the capacity of cationic dyes to stain only the nucleus and chromosomes in cells subjected to either acid or alkaline hydrolysis. The method and the squash were optimized for the Characeae and were described in detail. Nuclei from vegetative shoot apices and antheridial filament cells of unfixed, fixed and herbarium material of Nitella opaca were investigated using the Azure A or Toulidine Blue stains. Comparisons with some other staining methods, used in the previous studies, were also reported. The Azure A/Toulidine Blue method is useful to obtain clear images of chromosome morphology comparable or higher to that obtained with Feulgen or Aceto‐Orcein. It requires little time and a less complicated procedure in comparison with other staining methods.     

Enhancing the latent nucleotide triphosphate flexibility of the glucose-1-phosphate thymidylyltransferase RmlA

Nucleotidyltransferases are central to nearly all glycosylation-dependent processes and have been used extensively for the chemoenzymatic synthesis of sugar nucleotides. The determination of the NTP specificity of the model thymidylyltransferase RmlA revealed RmlA to utilize all eight naturally occurring NTPs with varying levels of catalytic efficiency, even in the presence of nonnative sugar-1-phosphates. Guided by structural models, active site engineering of RmlA led to alterations of the inherent pyrimidine/purine bias by up to three orders of magnitude. This study sets the stage for engineering single universal nucleotidyltransferases and also provides new catalysts for the synthesis of novel nucleotide diphosphosugars.     

Protein structure prediction assisted with sparse NMR data in CASP13

CASP13 has investigated the impact of sparse NMR data on the accuracy of protein structure prediction. NOESY and ¹⁵N-¹H residual dipolar coupling data, typical of that obtained for ¹⁵N,¹³C-enriched, perdeuterated proteins up to about 40 kDa, were simulated for 11 CASP13 targets ranging in size from 80 to 326 residues. For several targets, two prediction groups generated models that are more accurate than those produced using baseline methods. Real NMR data collected for a de novo designed protein were also provided to predictors, including one data set in which only backbone resonance assignments were available. Some NMR-assisted prediction groups also did very well with these data. CASP13 also assessed whether incorporation of sparse NMR data improves the accuracy of protein structure prediction relative to nonassisted regular methods. In most cases, incorporation of sparse, noisy NMR data results in models with higher accuracy. The best NMR-assisted models were also compared with the best regular predictions of any CASP13 group for the same target. For six of 13 targets, the most accurate model provided by any NMR-assisted prediction group was more accurate than the most accurate model provided by any regular prediction group; however, for the remaining seven targets, one or more regular prediction method provided a more accurate model than even the best NMR-assisted model. These results suggest a novel approach for protein structure determination, in which advanced prediction methods are first used to generate structural models, and sparse NMR data is then used to validate and/or refine these models.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

p16(MTS-1/CDKN2/INK4a) in cancer progression

Since its discovery as an inhibitor of cyclin-dependent kinases 4 and 6, the tumor suppressor p16 has continued to gain widespread importance in cancer. The high frequency of deletions of p16 in tumor cell lines first suggested an important role for p16 in carcinogenesis. This initial genetic evidence was subsequently strengthened by numerous studies documenting p16 inactivation in kindreds with familial melanoma. Moreover, a high frequency of p16 gene alterations was found in primary tumors, while recent studies have identified p16 promoter methylation as a major mechanism of tumor-suppressor-gene silencing. Additional insight into p16's role in cancer has come from the genetic analysis of precancerous lesions and various tissue culture models. It is now believed that loss of p16 is an early and often critical event in tumor progression. Consequently, p16 is a major tumor-suppressor gene whose frequent loss occurs early in many human cancers.