Heterologous expression of bovine and porcine beta-lactoglobulins in Pichia pastoris: towards a comparative functional characterisation

Bovine and porcine beta-lactoglobulins were cloned and expressed in host cells with the aim of developing the tools necessary for their structural, functional and conformational characterisation by NMR techniques. Both lipocalins were expressed in Pichia pastoris, where the use of a constitutive promoter turned out to allow the highest productivity. The yield of recombinant proteins was further improved through multiple integration of the encoding genes and by increasing aeration of the transformed cultures. Both proteins were obtained in the culture medium at the concentration of 200 microg/ml. Recombinant lipocalins were purified by ion-exchange chromatography from the culture medium. A preliminary NMR characterisation showed that both proteins were correctly folded.     

The selection of serum-independent PC12 cells for a more-reliable manganese cytotoxicity test

A major issue concerning the protocols of heavy metal cytotoxicity tests with PC12 cells was the hypothesis that serum in the culture medium might sequester the metal, thus altering the results obtained. However, serum withdrawal impairs the viability of PC12 cells themselves, thus impeding cytotoxicity testing in the absence of serum. In this study, we repeatedly selected undifferentiated, totally non-adherent PC12 cells in Petri dishes. Surprisingly, we discovered that these cells could survive and proliferate in serum-free medium. Moreover, features such as NGF-responsiveness, resazurin reduction potential, doubling rate, protein content, and basal caspase-3 enzyme activity, were equivalent to those exhibited by standard PC12 cultures. Further experiments aimed at fully characterising these serum-independent PC12 cells are in progress. These cells enabled cytotoxicity experiments to be conducted with manganese, both in serum-supplemented and in serum-deprived medium. The results demonstrated that serum removal decreased the LC50 of manganese from 250microM to 32microM, without affecting the internalisation of the metal. The data exclude an early competitive effect of serum on metal internalisation; rather, they suggest a late protective mechanism mediated by serum against the cytotoxic effect of the already-internalised metal.     

Molecular cytogenetic study of three common Mediterranean limpets, Patella caerulea, P. rustica and P. ulyssiponensis (Archaeogastropoda, Mollusca)

The present paper shows the results of chromosome banding and rDNA-FISH study performed on several specimens of different populations of Patella caerulea, Patella rustica and Patella ulyssiponensis. The taxonomic attribution of specimens was ascertained by the molecular phylogenetic analysis of the mitochondrial 16S rRNA gene. P. caerulea and P. rustica had 2n = 18 chromosomes with first seven of biarmed pairs and the remaining two uniarmed pairs. P. ulyssiponensis had 2n = 16 with all biarmed chromosomes. Ag-NOR loci were on the short arms of the first metacentric pair in the three studied limpets, whereas they showed a different pattern of heterochromatin distribution and composition. A chromosome mosaicism was observed in several P. caerulea specimens, which exhibited an unpaired metacentric element and loss of a telocentric pair. The obtained results suggest that in the genus Patella specific diversification was accompanied by variations in heterochromatin distribution and composition and reduction of chromosome number by Robertsonian centric fusion.     

The NMR solution structure of the 30S ribosomal protein S27e encoded in gene RS27_ARCFU of Archaeoglobus fulgidis reveals a novel protein fold

The Archaeoglobus fulgidis gene RS27_ARCFU encodes the 30S ribosomal protein S27e. Here, we present the high-quality NMR solution structure of this archaeal protein, which comprises a C4 zinc finger motif of the CX(2)CX(14-16)CX(2)C class. S27e was selected as a target of the Northeast Structural Genomics Consortium (target ID: GR2), and its three-dimensional structure is the first representative of a family of more than 116 homologous proteins occurring in eukaryotic and archaeal cells. As a salient feature of its molecular architecture, S27e exhibits a beta-sandwich consisting of two three-stranded sheets with topology B(decreasing), A(increasing), F(decreasing), and C(increasing), D(decreasing), E(increasing). Due to the uniqueness of the arrangement of the strands, the resulting fold was found to be novel. Residues that are highly conserved among the S27 proteins allowed identification of a structural motif of putative functional importance; a conserved hydrophobic patch may well play a pivotal role for functioning of S27 proteins, be it in archaeal or eukaryotic cells. The structure of human S27, which possesses a 26-residue amino-terminal extension when compared with the archaeal S27e, was modeled on the basis of two structural templates, S27e for the carboxy-terminal core and the amino-terminal segment of the archaeal ribosomal protein L37Ae for the extension. Remarkably, the electrostatic surface properties of archaeal and human proteins are predicted to be entirely different, pointing at either functional variations among archaeal and eukaryotic S27 proteins, or, assuming that the function remained invariant, to a concerted evolutionary change of the surface potential of proteins interacting with S27.     

Production of membrane proteins for NMR studies using the condensed single protein (cSPP) production system

In the Single Protein Production (SPP) method, all E. coli cellular mRNAs are eliminated by the induction of MazF, an ACA-specific mRNA interferase. When an mRNA for a membrane protein, engineered to have no ACA sequences without altering its amino acid sequence, is induced in the MazF-induced cells, E. coli is converted into a bioreactor producing only the targeted membrane protein. Here we demonstrate that three prokaryotic inner membrane proteins, two prokaryotic outer membrane proteins, and one human virus membrane protein can be produced at very high levels, and assembled in appropriate membrane fractions. The condensed SPP (cSPP) system was used to selectively produce isotope-enriched membrane proteins for NMR studies in up to 150-fold condensed culture without affecting protein yields, providing more than 99% cost saving for isotopes. As a novel application of the cSPP system for studies of membrane proteins prior to purification we also demonstrate, for the first time, fast detergent screening by microcoil NMR and well-resolved NMR spectra of several targeted integral membrane proteins obtained without purification.     

Solution NMR structure of the iron-sulfur cluster assembly protein U (IscU) with zinc bound at the active site

IscU is a highly conserved protein that serves as the scaffold for IscS-mediated assembly of iron-sulfur ([Fe-S]) clusters. We report the NMR solution structure of monomeric Haemophilus influenzae IscU with zinc bound at the [Fe-S] cluster assembly site. The compact core of the globular structure has an alpha-beta sandwich architecture with a three-stranded antiparallel beta-sheet and four alpha-helices. A nascent helix is located N-terminal to the core structure. The zinc is ligated by three cysteine residues and one histidine residue that are located in and near conformationally dynamic loops at one end of the IscU structure. Removal of the zinc metal by chelation results in widespread loss of structure in the apo form. The zinc-bound IscU may be a good model for iron-loaded IscU and may demonstrate structural features found in the [Fe-S] cluster bound form. Structural and functional similarities, genomic context in operons containing other homologous genes, and distributions of conserved surface residues support the hypothesis that IscU protein domains are homologous (i.e. derived from a common ancestor) with the SufE/YgdK family of [Fe-S] cluster assembly proteins.     

Relationships between polyamine metabolism and RNA synthesis in post-ischemic liver cell repair

In liver cells recovering from reversible ischemia the increase in RNA synthesis by isolated nuclei is preceded by activation of ornithine decarboxylase, leading in turn to an increase in putrescine concentration. Treatment of the animals with 1,3-diaminopropane and putrescine prevents ornithine decarboxylase activation but does not hinder the enhancement of RNA synthesis in post-ischemic liver nuclei; therefore, ornithine decarboxylase activation does not seem to be a necessary prerequisite for the increase in RNA synthesis. Hypophysectomy does not prevent the post-ischemic increases of ornithine decarboxylase and RNA synthesis; but pre-treatment of the animals with cycloheximide—which has a dual effect on the activity of ornithine decarboxylase—abolishes the post-ischemic enhancement of RNA synthesis. In contrast with regenerating liver, changes in ornithine decarboxylase activity and putrescine concentrations in reversible ischemia are not associated to changes in S-adenosylmethionine decarboxylase activity and in spermine and spermidine concentrations that seem to be characteristic of tissues where increases in RNA synthesis are followed by DNA synthesis and cell multiplication.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.