Candidose et tumeur obstructive intestinales chez un Babouin captif, ‘Papio Papio’ (Desm.)

Résumé Une candidose intestinale associée à une tumeur épithéliale, à métaplasie glandulaire, à pouvoir invasif marqué, provoquant une gêne du transit, a été découverte chez un Babouin de Guinée,Papio papio (Desm.) de la collection du Parc zoologique de Paris. A cette occasion nous avons rapporté les résultats concernant deux autres affections du tube digestid de nos Babouins captifs.

---

Report of a case of candidiasis of the digestive tract associated to an obstructive epithelial tumor, with great invasive ability, in a captive Baboon,Papio papio (Desm.). Included is a discussion of the incidence of some intestinal disturbances involving candidiasis of subhuman Primates.

     

Species differences in the effect of isoproterenol and pindolol on renin release in vitro.

The effects of selective beta adrenergic receptor stimulation with isoproterenol (3 X 10(-8) M) and of beta adrenergic blockade with pindolol (3 X 10(-5) M) on the renin release in vitro were investigated in incubated canine and rat kidney slices. Bioassay was used to measure the renin content of the tissue samples and incubation media; renin content in the canine incubation medium was measured also by radioimmunoassay. Isoproterenol in a concentration of 3 X 10(-8) M brought about a significant increase in the renin content of the incubation media as well as the tissue slices obtained from canine kidney, however, there was no change in these parameters under similar conditions if rat kidneys were incubated. Pindolol, on the other hand, in a concentration of 3 X 10(-5) M caused a significant decrease in the renin release from as well as in the renin content of the rat kidney slices, while canine kidney slices failed to respond to the same dose of the drug. The differences between the two species is suggested to be due to the differences in basal renin levels.     

The role of glucagon in the regulation of blood glucose: Model studies

Mathematical models afford a procedure of unifying concepts and hypotheses by expressing quantitative relationships between observables. The model presented indicates the roles of both insulin and glucagon as regulators of blood glucose, albeit in different ranges of the blood glucose concentrations. Insulin secretion is induced during hyperglycemia, while glucagon secretion results during hypoglycemia. These are demonstrated by simulations of a mathematical model conformed to data from the oral glucose tolerance test and the insulin infusion test in normal control subjects and stable and unstable diabetic patients. The model studies suggest the parameters could prove of value in quantifying the diabetic condition by indicating the degree of instability. Presented at the Society for Mathematical Biology Meeting, University of Pennsylvania, Philadelphia, August 19–21, 1976.     

Cellulose acetate electrophoresis of protein kinases: Detection of the active forms using various substrates

Electrophoresis on cellulose acetate strips was used to analyze protein kinases from normal rat liver. In addition to already well-characterized cAMP-dependent protein kinases type I and II and cAMP-independent casein kinases I and II, this method enabled the detection of several supplementary bands corresponding to kinases which were investigated according to their substrate specificity, activation by cAMP, and inhibition by the specific inhibitor of the catalytic subunit of cAMP-dependent protein kinases or by heparin. Using this rapid, sensitive, and resolutive electrophoretic method, different isozyme patterns could be obtained starting from minute amounts of different types of biological material.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër