Determining binding sites in protein–nucleic acid complexes by cross-saturation

Cross-saturation experiments have been shown to give accurate information regarding the interacting surfaces in protein-protein and protein-RNA complexes. The rate of magnetization transfer depends on a number of factors including geometry, spin topology, and effective correlation times. To assess the influence of these variables on such experiments, and to determine the range of applicability of the technique, we have simulated the time-course of magnetization transfer across the interface in a variety of protein-nucleic acid complexes (434 Cro, SRY, MetJ and U1A), each having a different binding geometry. The simulations have been carried out primarily to provide information about the experimentally accessible targets for selective saturation, such as the anomeric protons and the imino protons of the nucleic acid. Saturation of either of these groups of signals leads to partial excitation throughout the nucleic acid molecule, and the resulting transfer of saturation to the labelled protein moiety can be readily detected by the reduction in intensity of particular peaks in the HSQC spectrum of the protein. The simulations show that information can be obtained about the residues in contact with the nucleic acid without any need for deuteration. Experimental cross-saturation data have been obtained from the Mbp1-DNA complex and interpreted in conjunction with the simulations to map out the binding surface in detail.     

Gill ultrastructure and symbiotic bacteria in Codakia orbicularis (Bivalvia,Lucinidae)

Summary The cellular organization of the gill, which harbors symbiotic bacteria, is described in juveniles and adults of Codakia orbicularis, a large tropical Lucinidae. The ciliary zone is similar in every species of Lucinidae described and includes the large clear cell which has been previously described as an intermediary cell. The intermediary zone is composed of a few narrow unciliated cells, which bind adjacent filaments together and constitute channels through which sea water circulates along the abfrontal part of the filaments. The lateral zone is more complex in C. orbicularis than in other Lucinidae, being composed of four cell types and differentiated into two distinct regions. The bacteriocytes and intercalary cells occupy the outermost bacteriocyte zone, while mucocytes and numerous cells crowded with proteinic, cystine-rich granules constitute the innermost secretory zone which has not been described in other species. The newly described granule cells are considered to be a key factor in the storage and metabolic conversion of sulfur compounds.     

Solution structure of an EGF module pair from the Plasmodium falciparum merozoite surface protein 1.

The solution structure of the 96-residue C-terminal fragment of the merozoite surface protein 1 (MSP-1) from Plasmodium falciparum has been determined using nuclear magnetic resonance (NMR) spectroscopic measurements on uniformly13C/15N-labelled protein, efficiently expressed in the methylotrophic yeast Komagataella (Pichia) pastoris. The structure has two domains with epidermal growth factor (EGF)-like folds with a novel domain interface for the EGF domain pair interactions, formed from a cluster of hydrophobic residues. This gives the protein a U-shaped overall structure with the N-terminal proteolytic processing site close to the C-terminal glycosyl phosphatidyl inositol (GPI) membrane anchor site, which is consistent with the involvement of a membrane-bound proteinase in the processing of MSP-1 during erythrocyte invasion. This structure, which is the first protozoan EGF example to be determined, contrasts with the elongated structures seen for EGF-module pairs having shared Ca2+-ligation sites at their interface, as found, for example, in fibrillin-1. Recognition surfaces for antibodies that inhibit processing and invasion, and antibodies that block the binding of these inhibitory antibodies, have been mapped on the three-dimensional structure by considering specific MSP-1 mutants.     

Embryonic, Larval and Postlarval Development of the Tropical Clam, Anomalocardia Brasiliana (Bivalvia, Veneridae)

Anomalocardia brasiliana (Gmelin, 1791) is a venerid clam, distributed fromthe West Indies to Brazil, which lives shallowly burrowed inmuddy sands of mangrove lagoons in Guadeloupe. Development frominduced spawning to metamorphosed juveniles is described byusing light and scanning electron microscopy. The shell-fieldappears at the gastrula stage, 6 h after fertilization, andrapid embryonic development results in straight-hinge veligers, 18h after fertilization. These swimming veligers develop to swimming-crawlingpediveligers, then to benthic plantigrades with functional elongatedgill filaments without interruption in 15 days. The transitionalarched structures observed at the end of the pediveliger stagewere called `ctenidial crypts' to distinguish them from functionalgill filaments which exist only in metamorphosed juveniles.Metamorphosis, which occurs without a special environmental cue,is completed with the differentiation of the siphons in 300µmjuveniles. Thus, there is no delay of metamorphosis in thisspecies whereas a developmental hiatus has been described in mostplanktotrophic bivalves. Juveniles, 1 mm in shell-length withthe triangular shape, pointed posterior end and brown zig-zagstripes on the shell, typical of A. brasiliana have been obtained7 weeks after fertilization. However, a large variability ofindividual sizes and developmental stages within the same batchesmay indicate a high genetic variability. (Received 11 December 1997; accepted 30 April 1998)     

Determination of conformational transition rates in the trp promoter by 1H NMR rotating-frame T1 and cross-relaxation rate measurements

Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefèvre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s^–1 at 30 °C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the –35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence. Correspondence to: A. N. Lane