Analysis of teleost hemoglobin by Adair and Monod-Wyman-Changeux models

Summary The allosteric effects of the erythrocytic nucleoside triphosphates (NTP) and of proton concentrations were investigated by precise measurement of Hb–O₂ equilibria of tench hemoglobin (including extreme, high and low saturation ranges) and analysed in terms of the MWC two state model and the Adair four step oxygenation theory.At low concentrations (NTP/Hb ratio=1.0, and pH>7.3) ATP, GTP and protons decrease Hb–O₂ affinity by increasing the allosteric constantL and reducingK _T, the association constant¹ of the deoxy, tense state of the Hb, without significantly affecting that (K _R) of the oxy state, increasing the free energy of cooperativity (G). High concentrations of these effectors, however, also reduceK _R. The greater sensitivity of the half-saturation O₂ tension (P ₅₀) of the Hb to GTP than to ATP at the same concentration, correlates with greater effects of GTP on bothK _T andK _R. The pH and NTP dependence of the four Adair association constants and the calculated fractional populations of Hb molecules in different stages of oxygenation show that the autochthonous NTP effectors and protons stabilize the T structure and postpone the TR transition basic to cooperativity in fish Hb.The possible implications of the findings for aquatic respiration are discussed.Abbreviations ATP adenosine triphosphate - DPG 2,3-diphosphoglycerate (glycerate-2,3-bisphosphate) - GTP guanosine triphosphate - IHP inositol hexaphosphate - NTP nucleoside triphosphates In this paperK _T andK _R are defined as theassociation equilibrium constants instead of dissociation constants (as originally defined by Monod et al. 1965) to facilitate comparison with the Adair constants     

Influences of exercise-stress and adrenaline upon intra- and extracellular acid-base status,electrolyte composition and respiratory properties of blood in tench (Tinca tinca) at different seasons

Summary Exercise-stress in tench resulted in severe acidoses in both the red cells and the extracellular fluid in vivo. These coincident pH decreases conformed to the in vitro pH_i-pH_e relationship for tench blood in the oxygenated state. The extracellular acidosis was primarily respiratory in winter and metabolic in spring and summer. This was due to more effective buffering of metabolic protons in winter by an elevation in [HCO ₃ ^– ] levels, rather than to differences in the lactic- and carbonic acid loads. A good correspondence was found between buffered metabolic protons and increases in [lactate].There was no evidence for -adrenergic red cell swelling and associated red cell pH changes in tench both after exercise and adrenaline infusion. Arterial O₂ transport was, however, improved in exercise by pronounced increases in .Large increases in plasma potassium concentration and small elevations of chloride and calcium levels occurred in exercise. Hematocrit and blood [Hb] also increased, probably due to an adrenergic release of erythrocytes from the spleen, but these increases were small and appeared unimportant for blood O₂ transport.Seasonal differences were found in exercise-induced changes in [lactate], in the magnitude of electrolyte and changes, as well as in resting values for pH_e, pH_i, [HCO ₃ ^– ], [Cl^–] and [Ca⁺⁺]. The origin and importance of these are discussed.     

Effects of cultivation techniques and media on yields and morphology of the basidiomycete Armillaria mellea

Summary The yield of cell mass and the morphology of Armillaria mellea, strain ATCC 11114, was studied using a variety of cultivation methods: solid media, standing liquid culture, shake flasks, tower reactors and impeller-stirred reactors. Two different media, malt extract broth and a glucose/asparagine/peptone-medium, and the corresponding agar media, were used. Yields were higher in the malt extract media than in the glucose media. Generally the highest yields were obtained on solid media while agitated cultures gave the lowest yields. Morphological characteristics such as pellet formation, adhesion to surfaces and pigment production were significantly affected by culture conditions.     

The population dynamics of Cheilosia fasciata (Diptera,Syrphidae): significance of environmental factors and behavioural adaptations in a phytophagous insect

Summary A population of Cheilosia fasciata Schin. & Egg., 1853 was studied in a beech forest (Melico-Fagetum allietosum) near Göttingen (FRG). This syrphid species is closely associated with ramson (Allium ursinum L.), as the larvae mine the plant's leaves. Adult abundance was determined using emergence traps (1981–1986); egg and larval abundance was determined by examining ramson leaves: puparia were extracted from soil samples (1984 and 1986). Cheilosia fasciata is a univoltine species; the imagines emerge in late April/early May. Larval development took five (1986) to six (1984) weeks. In late June/early July the larvae enter the soil for pupariation. A linear relationship was found between the area of the mines and larval biomass (dry wt.). It was concluded that one larva had to mine 51.90 cm² of leaf area in order to gain the mean maximum dry weight (11.15 mg). Furthermore, it was shown that ovipositing females, laying just one egg per leaf, tended to select large leaves providing this minimum amount of food. It is hypothesized that females probably follow straight-lined routes on their oviposition flights, rather than ovipositing on leaves chosen at random. By applying such a strategy, females can almost completely avoid competition for food among their own offspring. Furthermore, competition among the progeny of the whole population is also reduced, particularly in years when adult abundance is very low. The significance of certain factors influencing the population dynamics of Cheilosia fasciata was evaluated by applying a rank correlation analysis. It was shown that high precipitation rates in April reduced the time available for mating and oviposition resulting in low emergence abundance in the next spring. Larval survivorship was enhanced by high precipitation rates in May and June, indicating that drought may be unfavourable to larvae and reduce food availability. Predation by a parasitoid Phygadeuon ursini Horstmann, 1986 (Hymenoptera, Ichneumonidae), appears to be just an imperfect (Milne 1984) density-dependent control mechanism; in fact, it was shown that food limitation is the only significant mechanism of density-dependent population control.     

Natural and Chernobyl-caused radioactivity in mushrooms,mosses and soil-samples of defined biotops in SW Bavaria

Summary Different mushrooms, mosses and corresponding soil samples have been collected mainly from two sites in the alpine region of southwestern Bavaria. At the end of the growthseason, September 1986, gamma spectroscopic analysis showed that the moss-, mould, and needle-layer contained considerably more ¹³⁴Cs and ¹³⁷Cs activity per unit fresh weight than eight different species of mushroom. These two isotopes were carried into the biotop mainly as a consequence of the Chernobyl accident. ¹³¹J could not be found any more in the samples ca. 5–6 months after the catastrophe. The activity of the cesium isotopes decreased with increasing soil depth. In the mushrooms the activity was relatively high in Xerocomus badius and surprisingly low in Boletus edulis; samples of the latter and of Cantharellus cibarius collected in September 1985 (before the accident) and kept deep frozen contained almost identical amounts of ¹³⁷Cs as those collected from August to October 1986. Mushrooms contained considerably more of the natural isotope ⁴⁰K than the needlelayers and the soil samples in the neighbourhood. In all mushrooms except Xerocomus badius the activity of ⁴⁰K was generally higher than the ¹³⁷Cs activity. The results indicate that except Xerocomus badius the analyzed mushrooms do not actively take up Cs from the soil, in contrast to K.     

The Susceptibility of Photosynthesis to Photoinhibition and the Capacity of Recovery in High and Low Light Grown Cyanobacteria, Anacystis nidulans

The susceptibility of photosynthesis to photoinhibition and the rate of its recovery were studied in the cyanobacterium Anacystis nidulans grown at a low (10 micromoles per square meter per second) and a high (120 micromoles per square meter per second) photosynthetically active radiation. The rate of light limited photosynthetic O₂ evolution was measured to determine levels of photoinhibition and rates of recovery. Studies of photoinhibition and recovery with and without the translation inhibitor streptomycin demonstrated the importance of a recovery process for the susceptibility of photosynthesis to photoinhibition. We concluded that the approximately 3 times lower susceptibility to photoinhibition of high light than of low light grown cells, significantly depended on high light grown cells having an approximately 3 times higher recovery capacity than low light grown cells. It is suggested that these differences in susceptibility to photoinhibition and recovery depends on high light grown cells having a higher turnover rate of photosystem II protein(s) that is(are) the primary site(s) of photodamage, than have low light grown cells. Furthermore, we demonstrated that photoinhibition of A. nidulans may occur under physiological light conditions without visible harm to the growth of the cell culture. The results give support for the hypotheses that the net photoinhibitory damage of photosystem II results from the balance between the photoinhibitory process and the operation of a recovery process; the capacity of the latter determining significant differences in the susceptibility of photosynthesis to photoinhibition of high and low light grown A. nidulans.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Cartilage electromechanics--II. A continuum model of cartilage electrokinetics and correlation with experiments

We have formulated a continuum model for linear electrokinetic transduction in cartilage. Expressions are derived for the streaming potential and streaming current induced by oscillatory, uniaxial confined compression of the tissue, as well as the mechanical stress generated by a current density or potential difference applied to the tissue. The experimentally observed streaming potential and current-generated stress response, measured on the same specimens, are compared with the predictions of the theory over a wide frequency range. The theory compares well with the data for reasonable values of cartilage intrinsic mechanical parameters and electrokinetic coupling coefficients. Experiments also show a linear relationship between the stimulus amplitude and the transduction response amplitude, within the range of stimulus amplitudes of interest. This observation is shown to be consistent with the predictions of the linear theory.     

G6PD Punjab,a dialysis sensitive variant of human glucose-6-phosphate dehydrogenase

Erythrocyte samples from 101 individuals, originally from Punjab and living at the time of investigation in England, were screened for glucose-6-phosphate dehydrogenase (G6PD) variants by Beutler’s fluorescent spot test and standard cellulose acetate gel (Cellogel) electrophoresis. All but 2 of the 40 males in the study were found to be indistinguishable from normal G6PD B. One of the variants had 2% of the normal activity and resembled G6PD Mediterranean in electrophoretic behaviour. The other variant showed 52% of the normal activity and migrated slower than G6PD B in Cellogel with about half of the normal band intensity. A set of physicochemical characteristics of the variant determined by conventional methods distinguished it from the variants reported so far. It was designated as G6PD Punjab, and the corresponding allele asG6PD PUN. The most striking feature of G6PD Punjab is a remarkable alteration in its electrophoretic behaviour after dialysis.