Intracellular localisation of phytochrome and ubiquitin in red-light-irradiated oat coleoptiles by electron microscopy

The intracellular localisation of phytochrome and ubiquitin in irradiated oat coleoptiles was analysed by electron microscopy. We applied indirect immunolabeling with polyclonal antibodies against phytochrome from etiolated oat seedlings or polyclonal antibodies against ubiquitin from rabbit reticulocytes, together with a goldcoupled second antibody, on serial ultrathin sections of resin-embedded material. Immediately after a 5-min pulse of red light-converting phytochrome from the red-absorbing (Pr) to the far-redabsorbing (Pfr) form-the label for phytochrome was found to be sequestered in electron-dense areas. For up to 2 h after irradiation, the size of these areas increased with increasing dark periods. The ubiquitin label was found in the same electrondense areas only after a dark period of 30 min. A 5 min pulse of far-red light, which reverts Pfr to Pr, given immediately after the red light did not cause the electron-dense structures to disappear; moreover, they contained the phytochrome label immediately after the far-red pulse. In contrast, after the reverting far-red light pulse, ubiquitin could only be visualised in the electron-dense areas after prolonged dark periods (i.e. 60 min). The relevance of these data to light-induced phytochrome pelletability and to the destruction of both Pr and Pfr is discussed.Abbreviations FR far-red light; Pfr - Pr far-red-absorbing and red-absorbing forms of phytochrome, respectively - R red light     

Light-induced changes in the amounts of the 36000-Mr polypeptide of NADPH-protochlorophyllide oxidoreductase and its mRNA in barley plants grown under a diurnal light/dark cycle

Seedlings of barley were grown either in continuous darkness or under a diurnal 12 h light/12 h dark cycle and the effects on NADPH-protochlorophyllide oxidoreductase were followed at two different levels. Firstly, the relative content of the mRNA encoding the NADPH-protochlorophyllide oxidoreductase was measured by dot-blot hybridization. Secondly, changes in the enzyme polypeptide were monitored either by the method of immunoblotting or by immunogold labelling of ultrathin sections of Lowicryl-embedded leaf tissue. Our results demonstrate that drastic diurnal changes in the level of mRNA sequences and the enzyme protein are unlikely to occur in plants which have been grown under natural light/dark conditions. In the dark, protein and mRNA accumulation occurs at an early developmental stage. These results are difficult to reconcile with the suggestion that the massive accumulation of mRNA and enzyme protein in dark-grown seedlings is primarily the consequence of an artificially extended darkperiod. In addition to the plastid-specific NADPH-protochlorophyllide oxidoreductase a closely related polypeptide has been detected outside the plastid in the surrounding cytoplasm (Dehseh et al. 1986b, Planta 169, 172–183). During the diurnal light/dark treatment of seedlings the concentrations of the two protein populations did not show any variation indicative of an exchange between the two protein populations across the plastid envelope.Abbreviation poly(A)⁺RNA polyadenylated RNA     

Plant responses to H2S and SO2 fumigation. I. Effects on growth, transpiration and sulfur content of spinach

Exposure of spinach (Spinacia oleracea L. cv. Monosa) to 0.25 μl l_?1 H₂S reduced the relative growth rate by 26, 47 and 60% at 15, 18 and 25°C, respectively. Shoot to root ratio decreased in plants fumigated at 18 and 25°C. Growth of spinach was not affected by a 2-week exposure to 0.10 or 0.25 μl l_?1 SO₂. Both H₂S and SO₂ fumigation increased the content of sulfhydryl compounds and sulfate. A 2-week exposure to 0.25 μl l_?1 H₂S resulted in an increase in sulfhydryl and sulfate content of 250 to 450% and 63 to 248% in the shoots, respectively, depending on growth temperature. Exposure to 0.15 and 0.30 μl l_?1 H₂S at 20°C for 2 weeks resulted in a 46% increase in sulfate content of the shoots at 0.30 μl l_?1 and no detectable increase at 0.15 μl l_?1 H₂S; the sulfate content of the roots increased by 195 and 145% at 0.15 and 0.30 μl l_?1 H₂S, respectively. Fumigation with 0.25 μl l_?1 SO₂ at 20°C for 2 weeks resulted in an increase in sulfhydryl content and sulfate content in the shoots of 285% and 300 to 1100%. H₂S fumigation during the 12 h light period or only during the dark period resulted in identical growth reduction and accumulation of sulfhydryl compounds; they were about 50 and 67% of those observed in continuously exposed plants. H₂S- and SO₂-exposed plants showed an increased transpiration rate, which was mainly caused by an increased dark-period transpiration. No effect of H₂S and SO₂ on the water uptake of the plants and the osmotic potential of the leaves was detected. Plants fumigated with 0.25 μl l_?1 H₂S for 2 weeks were smaller and differed morphologically from the control plants by slightly more abaxially curved leaf margins. Cross sections of the leaves showed smaller cells at the margins and smaller and fewer air spaces. The increased transpiration in the H₂S-exposed plants is discussed in relation to the observed morphological changes.     

Influx of na, k, and ca into roots of salt-stressed cotton seedlings : effects of supplemental ca

High Na⁺ concentrations may disrupt K⁺ and Ca²⁺ transport and interfere with growth of many plant species, cotton (Gossypium hirsutum L.) included. Elevated Ca²⁺ levels often counteract these consequences of salinity. The effect of supplemental Ca²⁺ on influx of Ca²⁺, K⁺, and Na⁺ in roots of intact, salt-stressed cotton seedlings was therefore investigated. Eight-day-old seedlings were exposed to treatments ranging from 0 to 250 millimolar NaCl in the presence of nutrient solutions containing 0.4 or 10 millimolar Ca²⁺. Sodium influx increased proportionally to increasing salinity. At high external Ca²⁺, Na⁺ influx was less than at low Ca²⁺. Calcium influx was complex and exhibited two different responses to salinity. At low salt concentrations, influx decreased curvilinearly with increasing salt concentration. At 150 to 250 millimolar NaCl, ⁴⁵Ca²⁺ influx increased in proportion to salt concentrations, especially with high Ca²⁺. Potassium influx declined significantly with increasing salinity, but was unaffected by external Ca²⁺. The rate of K⁺ uptake was dependent upon root weight, although influx was normalized for root weight. We conclude that the protection of root growth from salt stress by supplemental Ca²⁺ is related to improved Ca-status and maintenance of K⁺/Na⁺ selectivity.     

Basic peroxidases in isolated vacuoles of nicotiana tabacum L.

Vacuoles of tobacco mesophyll and of suspension-cultured cells were isolated in order to study the localization of peroxidase isoenzymes. Only basic peroxidases were detectable by electrophoretic separation of the vacuolar sap. Some of the basic peroxidases have formerly been described as an ionically bound cell-wall fraction. This fraction, however, was found to be an artifact produced by incomplete cell breakage. Reinvestigation of isolated cell walls confirmed that mainly acidic peroxidases are localized in the cell walls where they move freely or are bound. As a consequence of former and present results we think it probable that all of the peroxidase isoenzymes are secretory proteins because they have to be transported from the sites of synthesis in the cytoplasm to the sites of function, the extracytoplasmic spaces, cell wall (acidic peroxidases), and vacuole (basic peroxidases).Abbreviation ER endoplasmic reticulum - PAGE polyacrylamide gel electrophoresis     

Site-directed mutagenesis to determine essential residues of ribulose-bisphosphate carboxylase ofRhodospirillum rubrum

Both Lys-166 and His-291 of ribulosebisphosphate carboxylase/oxygenase fromRhodospirillum rubrum have been implicated as the active-site residue that initiates catalysis. To decide between these two candidates, we resorted to site-directed mutagenesis to replace Lys-166 and His-291 with several amino acids. All 7 of the position-166 mutants tested are severely deficient in carboxylase activity, whereas the alanine and serine mutants at position 291 are ∼40% and ∼18% as active as the native carboxylase, essentially ruling out His-291 in theRhodospirillum rubrum carboxylase (and by inference His-298 in the spinach enzyme) as a catalytically essential residue. The ability of some of the mutant proteins to undergo carbamate formation or to bind either ribulosebisphosphate or a transition-state analogue remains largely unimpaired. This implies that Lys-166 is not required for substrate binding; rather, the results corroborate the earlier postulate that Lys-166 functions as an acid-base group in catalysis or in stabilizing a transition state in the reaction pathway.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.