Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Cartilage electromechanics--II. A continuum model of cartilage electrokinetics and correlation with experiments

We have formulated a continuum model for linear electrokinetic transduction in cartilage. Expressions are derived for the streaming potential and streaming current induced by oscillatory, uniaxial confined compression of the tissue, as well as the mechanical stress generated by a current density or potential difference applied to the tissue. The experimentally observed streaming potential and current-generated stress response, measured on the same specimens, are compared with the predictions of the theory over a wide frequency range. The theory compares well with the data for reasonable values of cartilage intrinsic mechanical parameters and electrokinetic coupling coefficients. Experiments also show a linear relationship between the stimulus amplitude and the transduction response amplitude, within the range of stimulus amplitudes of interest. This observation is shown to be consistent with the predictions of the linear theory.     

Modulation of FcR function by complement: subcomponent C1q enhances the phagocytosis of IgG-opsonized targets by human monocytes and culture-derived macrophages

We have investigated the interaction of C1q, a subunit of the first component of complement, with human monocytes and culture-derived macrophages. Adherence of these mononuclear phagocytes to surfaces coated with C1q induced a marked enhancement of the phagocytosis of sheep erythrocytes opsonized with IgG anti-Forssman antibody (EA-IgG). This C1q-mediated enhancement of phagocytosis was dose dependent, and was specifically blocked by pretreatment of the C1q-coated surfaces with F(ab')2 anti-C1q. The augmentation of FcR-mediated phagocytosis by C1q was determined to be a result of the interaction between the C1q and the phagocytic effector cell, and was not due to interaction between the surface-bound C1q and the EA-IgG. Neither resting nor N-formyl-methionyl-leucyl-phenylalanine-stimulated polymorphonuclear leukocytes were induced by C1q to increase FcR-mediated phagocytosis. Experiments conducted with purified fragments of C1q suggest that the C1q phagocytosis enhancement signal resides in the collagen-like tail domain of the molecule. This region is the same portion of the molecule previously shown to interact with the cell surface C1q receptor. Native type I collagen was unable to enhance FcR-mediated phagocytosis by mononuclear phagocytes. It has been demonstrated that C1q can be localized to areas of inflammation, and additionally C1q can be secreted by macrophages in culture. In view of these findings and the results of our present study, we hypothesize that C1q could provide local, direct, and non-opsonic enhancement of phagocytosis by mononuclear phagocytes in areas of infection and inflammation.     

Feeding responses to solanaceous allelochemicals by larvae of the tobacco hornworm, Manduca sexta

Feeding responses of the oligophagous tobacco hornworm to allelochemicals prevalent in their host plants were determined in food choice-tests using filter paper discs laced with a test solution or water (control). Six solanaceous alkaloids, tomatine, tomatidine, solanine, solanocapsine, atropine and nicotine, were tested and only tomatine and solanocapsine were found to influence preference behavior. Solanocapsine (5 mM) deters feeding whereas tomatine (1 mM) stimulates feeding slightly. No synergistic effect of either tomatine or tomatidine with sucrose was found.The responses to tomatine are affected by previous feeding experience. Tomatine slightly stimulates feeding in larvae reared on tomato (Lycopersicon esculentum), but slightly deters feeding in larvae reared on Jerusalem cherry (Solanum pseudocapsicum). Such induced preference is absent for the other alkaloids tested, which indicates that these alkaloids do not by themselves induce preferences for the plants containing them.The non-alkaloid allelochemicals, chlorogenic acid, rutin, and 2-tridecanone also influenced food choice behavior. Chlorogenic acid is slightly stimulatory at its natural concentration (1mM), but strongly deterrent at higher concentrations. Rutin stimulates feeding in a concentration-dependent manner. Its activity must be due to the glycosylated structure, because both the aglycone (quercetin) and the sugar moiety (rutinose) are neutral. Removal of the glucose part of rutin, as in quercitrin, results in feeding deterrent activity. 2-Tridecanone is neutral at its concentration in cultivated tomato (1 mM), but strongly deterrent and toxic at higher concentrations. Preference behavior is not affected by solanesol, GABA, and a mixture of host plant compounds stimulatory for anothe solanaceous-specific feeder, the Colorado potato beetle (Leptinotarsa decemlineata).We conclude that the prevalent solanaceous alkaloids and other allelochemicals tested do not play important roles in food selection of the tobacco hornworm, although some may make small contributions.

---

Résumé Des experiences de choix de chenilles oligophages de M. sexta ont été réalisees avec des disques de papier filtre imbiles d'eau ou de solutions des substances allélochimiques dominantes dans les plantes consommées. Sur les six alcaloïdes de solanées examinés: tomatine, tomatidine, solanine, solanocapsine, atropine et nicotine, seuls la tomatine et la solanocapsine ont influé sur le choix; la solanocapsine (5 mM) empêche la prise de nourriture, tandis que la tomatine (1 mM) la stimule légèrement. Aucun effet synergique de la tomatine ou de la tomatidine n'a été observé en présence de sucrose.La réponse à la tomatine est modifiée par la prise de nourriture antérieure. Elle stimule légèrement l'alimentation de chenilles élevées sur tomates (Lycopersicon esculentum), mais dissuade légèrement les chenilles élevées sur Solanum pseudocapsicum. II n'y a pas d'action induite semblable avec les autres alcalïdes examinés, ce qui indique que ces alcaloïdes ne peuvent pas induire par eux-mêmes de préférences pour les plantes qui les contiennent.Des substances allélochimiques non-alcaloïdes: acide chlorogénique, rutine, et 2-tridécanone, influent aussi sur le comportement de choix alimentaire. L'acide chlorogénique est légèrement stimulant à sa concentration naturelle (1 mM), mais fortement dissuasif aux concentrations supérieures. La rutine stimule la prise de nourriture en fonction de sa concentration. Son activité doit être due à sa structure glucosylate, puisqu'aussi bien l'aglycone (quercitine) que la moiteé sucrée (rutinose) sont neutres. La suppression de la partie glucose de la rutine, comme dans le cas de la quercitine, a un effet dissuasif. A sa concentration dans la tomate cultivée (1 mM), le 2-tridécanone est neutre, mais il est fortement dissuasif et toxique à des concentrations supérieures.Le comportement de choix n'est pas modifié par le solanésol, le GABA, et par un mélange de composés végétaux stimulant un consommateur spécifique de solanées, comme le doryphore (Leptinotarsa decemlineata).Nous pouvons conclure que les principaux alcaloïdes et autres substances allélochimiques des solanées que nous avons examinés n'interviennent pas d'une façon importante, mais peuvent avoir une influence secondaire, dans les choix alimentaires de Manduca sexta.

     

Biochemical characterization of polypeptide components involved in neurite fasciculation and elongation

Polypeptide components and carbohydrate linkage types of F11 antigen and G4 antigen, two chick cell-surface glycoproteins implicated in neurite fasciculation and elongation [Rathjen, F.G., Wolff, J.M., Bonhoeffer, F. and Rutishauser, U. (1987) J. Cell Biol. 104, 343-353], have been studied in comparison to mouse L1 antigen. Tryptic fingerprint analysis does not reveal any relation of the 130-kDa components of G4 or F11 antigens to each other or to neural cell-adhesion molecules. The 180/190-kDa component of G4 antigen comprises parts of the 130-kDa and 80/65-kDa components and shares a sequence corresponding to the amino terminus of the G4 130-kDa component as shown serologically with anti-peptide sera. This closely parallels the relationship found for mouse L1 antigen components. In contrast, the F11 170-kDa component is different from the F11 130-kDa component, as shown serologically and by fingerprint analysis. A combination of chemical and enzymatic deglycosylation methods reveals that while O-glycosylation cannot be detected F11 130-kDa, G4 130-kDa and L1 140-kDa components contain N-linked carbohydrates. Endoglycosidase H treatment shows that the oligosaccharides present in the G4 130-kDa component and mouse L1 are mostly of the complex type, while the F11 130-kDa component consists of two populations, one containing mainly complex-type carbohydrates and a second containing high-mannose/hybrid-type carbohydrates.     

N-Deacetylation of 2-acetamido-2-deoxy-hexosecontaining oligosaccharides and polysaccharides by calcium in liquid ammonia

N-Deacetylation of 2-acetamido-2-deoxy-hexose residues is accomplished in liquid ammonia containing calcium. Oligosaccharides, lacto-N-fucopentaose II and lacto-N-difucohexaose I, containing 3,4-disubstitutedN-acetylhexosamine residues are quantitativelyN-deacetylated. When applied to polysaccharides, however, only partialN-deacetylation was achieved.Author for correspondence. AXRD     

Isolation and characterization of cDNA clones encoding the 17.9 and 8.1 kDa subunits of Photosystem I from Chlamydomonas reinhardtii

cDNA clones encoding two Photosystem I subunits of Chlamydomonas reinhardtii with apparent molecular masses of 18 and 11 kDa (thylakoid polypeptides 21 and 30; P21 and P30 respectively) were isolated using oligonucleotides, the sequences of which were deduced from the N-terminal amino acid sequences of the proteins. The cDNAs were sequenced and used to probe Southern and Northern blots. The Southern blot analysis indicates that both proteins are encoded by single-copy genes. The mRNA sizes of the two components are 1400 and 740 nucleotides, respectively. Comparison between the open reading frames of the cDNAs and the N-terminal amino acid sequences of the proteins indicates that the molecular masses of the mature proteins are 17.9 (P21) and 8.1 kDa (P30). Analysis of the deduced protein sequences predicts that both subunits are extrinsic membrane proteins with net positive charges. The amino acid sequences of the transit peptides suggest that P21 and P30 are routed towards the lumenal and stromal sides of the thylakoid membranes, respectively.Abbreviations OEE1, 2 and 3 oxygen evolution enhancer proteins 1, 2 and 3 - Rubisco ribulose bisphosphate carboxylase/oxygenase - PS photosystem - P21 and P30 C. reinhardtii thylakoid polypeptides 21 and 30     

Tissue distribution of beta 1- and beta 2-subunits of regulatory guanine nucleotide-binding proteins

The beta-subunit of G-proteins occurs in two forms (beta 1 and beta 2), which differ in their primary structure as derived from cDNA clones and in their mobilities on SDS gels (36 and 35 kDa, respectively). To assess the tissue distribution of the two forms of beta-subunits, we synthesized peptides corresponding to defined regions of beta 1- and beta 2-subunits and injected them into rabbits; the antisera obtained reacted either with both beta-subunits or specifically with the beta 1- or the beta 2-subunit. They were used to identify the two beta-subunits in membranes prepared from various rat tissues and from human placenta. The concentration of total beta-subunits was high in rat brain and lung, human placenta, rat kidney, liver and spleen; it was much lower in rat erythrocytes, cardiac and skeletal muscle. In all tissues studied, both beta 1- and beta 2-subunits were detectable. In most tested tissues, the two forms were about equally distributed, whereas in the placenta, the beta 2-subunit was found to occur in approx. 2-fold excess over the beta 1-subunit. Our results demonstrate that both beta-subunits are widely distributed. In the majority of tissues, levels of beta 2-subunits are very similar to those of beta 1-subunits. Thus, the abundance of beta 2-subunits as compared to that of the beta 1-subunit is considerably higher than was previously estimated by measuring the respective mRNA levels.     

Visual optics in toads (Bufo americanus)

Aspects of visual optics were investigated in the American toad (Bufo americanus). The development of the refractive state of the eye during metamorphosis was followed with IR photoretinoscopy. Frozen sections documented the changes in optical parameters before and after metamorphosis. There is a difference in light sensitivity between juvenile and adult toads. Binocular accommodation in adult toads was observed. 1. IR photoretinoscopic measurements showed that the refractive state of the eye changed very rapidly during metamorphosis, about 10 D/h while the animal entered the terrestrial habitat. 2. Frozen sections showed that the almost spherical lens in a tadpole eye had flattened in a just metamorphosed toad's eye while at the same time the distance of the lens to the retina had decreased. However, the morphological measurements were not sufficiently sensitive to record the relatively small changes in ocular dimensions that were responsible for the rapid changes in refractive state during metamorphosis. 3. Schematic eyes, with homogeneous and non homogeneous lenses, were constructed for tadpoles, juvenile toads, and adult toads. 4. Nonparaxial raytracing studies in schematic eyes suggested that the lenses of animals of the three developmental stages tadpole, juvenile toad, and adult are not homogeneous but have a refractive index gradient. The raytracing studies indicated that the refractive index gradient is different for the different developmental stages, being highest in the tadpole lens. 5. The observations of toads during feeding behavior at different light levels showed an increased light sensitivity in the adult nocturnal toads in contrast to the juvenile animals, which are diurnal. The increased light sensitivity could partly be explained with an increase in aperture and an increase in red rod outer segments. To fully explain the higher light sensitivity in adult toads, changes in neuronal parameters had to be assumed. 6. Retinoscopic measurements of the resting refractive state in the adult toad showed a hyperopic defocus of about +8 D. By subtracting the measurement artefact for retinoscopy, the true resting focus was found to be nearly emmetropic. 7. The amount of natural accommodation in adult toads during normal feeding behavior was investigated with IR photoretinoscopy. Binocular accommodation of about 8 D was observed.     

Nyctohemeral Rhythms of Gonadal, Thyroid and Pineal Function in the Hyperprolactinemic Male Rat

In young adult male rats bearing a donor anterior pituitary gland grafted for 3 weeks under a kidney capsule, serum prolactin (PRL) concentrations were elevated and exhibited a rhythm with the highest values in the light phase. Serum PRL in control animals did not exhibit a significant rhythm. Eutopic pituitary PRL content, manifesting a biphasic (12-hr) rhythm with crests during the day and night in controls, exhibited a similar pattern in grafted rats though an overall reduction in pituitary PRL content was seen in the grafted animals. Neither the normal biphasic serum testosterone rhythm nor the normal 24-hr rhythm (nocturnal surge) of pineal N-acetyltransferase activity and melatonin content were altered in the hyperprolactinemic rats. Serum thyroxine (T₄) and triiodothyronine (T₃) and their free indices (FT₄ I, FT₃ I) and serum thyrotropin (TSH) were highest during the day in controls and grafted rats and a 12-hr rhythmic component was detected in data for these variables. In the grafted animals, the 12-hr component was reflected in an additional peak at night detectable by testing of means. The overall serum T₄ FT₄ I, and TSH levels were lower in grafted rats though overall T₃ and FT₃I levels did not differ between grafted and controls. T₃ uptake (T₃ U) values were similar between controls and grafted rats, in both cases exhibiting a fall during the night. Changes in serum thyronines could not be explained by changes in serum binding as assessed by the T₃U₃ and thus may represent changes in thyroidal secretion of T₄. The rhythm in serum PRL of grafted rats suggests the presence of rhythmic circulating factor(s) capable of influencing ectopic lactotrophs. The reduced eutopic pituitary PRL content suggests a role for PRL in influencing eutopic lactotrophs in the pituitary-grafted hyperprolactinemic male rat model. Though circulating testosterone and pineal melatonin synthesis were not altered in this model, thyroid function appeared to be so.