Current perspectives on biosimilars

In this work, an overview of the biosimilars market, pipeline and industry targets is discussed. Biosimilars typically have a shorter timeline for approval (8 years) compared to 12 years for innovator drugs and the development cost can be 10–20% of the innovator drug. The biosimilar pipeline is reviewed as well as the quality management system (QMS) that is needed to generate traceable, trackable data sets. One difference between developing a biosimilar compared to an originator is that a broader analytical foundation is required for biosimilars and advances made in developing analytical similarity to characterize these products are discussed. An example is presented on the decisions and considerations explored in the development of a biosimilar and includes identification of the best process parameters and methods based on cost, time, and titer. Finally factors to consider in the manufacture of a biosimilar and approaches used to achieve the target-directed development of a biosimilar are discussed.

     

Immunoglobulin-free light chains elicit immediate hypersensitivity-like responses

Immunoglobulin (Ig)-free light chains IgLC are present in serum and their production is augmented under pathological conditions such as multiple sclerosis, rheumatoid arthritis and neurological disorders. Until now, no (patho)physiological function has been ascribed to circulating Ig light chains. Here we show that IgLCs can confer mast cell dependent hypersensitivity in mice. Antigenic stimulation results in plasma extravasation, cutaneous swelling and mast-cell degranulation. We show that IgLCs have a crucial role in development of contact sensitivity, which could be completely prevented by a novel IgLC antagonist. Although IgE and IgG(1) are central to the induction of immediate hypersensitivity reactions, our results show that IgLCs have similar activity. IgLCs may therefore be a novel factor in the humoral immune response to antigen exposure. Our findings open new avenues in investigating the pathogenesis of autoimmune diseases and their treatments.     

Determination of residual dipolar couplings in homonuclear MOCCA-SIAM experiments

In solutions with partial molecular alignment, anisotropic magnetic interactions such as the chemical shift anisotropy, the electric quadrupole interaction, and the magnetic dipole-dipole interaction are no longer averaged out to zero in contrast to isotropic solutions. The resulting residual anisotropic magnetic interactions are increasingly used in biological NMR studies for the determination of 3D structures of proteins and other biomolecules. In the present paper we propose a new approach allowing the measurement of residual H^N-H dipolar couplings of non-isotope enriched proteins based on the application of the MOCCA-SIAM experiment. This experiment allows the measurement of homonuclear coupling constants with an accuracy of ca. ±0.2 Hz and is therefore particularly well suited to determine residual dipolar couplings at relatively low degrees of molecular orientation. The agreement between experimentally determined residual H^N-H couplings and calculated values is demonstrated for BPTI.     

Pigment compositions,spectral properties,and energy transfer efficiencies between the xanthophylls and chlorophylls in the major and minor pigment-protein complexes of photosystem II

Absorption, fluorescence, and fluorescence excitation spectra have been measured from CP26, CP29, and monomeric and trimeric LHCIIb light-harvesting complexes isolated from Photosystem II subchloroplast particles from spinach. The complexes were purified using a combination of isoelectric focusing and sucrose gradient ultracentrifugation. The chlorophyll (Chl) and xanthophyll pigment compositions were measured using high-performance liquid chromatography (HPLC). Using the pigment compositions from the HPLC analysis as a starting point, the absorption spectral profiles of the complexes have been reconstructed from the individual absorption spectra obtained for each of the pigments. Also, the fluorescence excitation spectra of the complexes have been deconvoluted. The data reveal the energy transfer efficiencies between Chl b and Chl a and between specific xanthophylls and Chl a in the complexes. The spectral analyses reveal the underlying features of the highly congested spectral profiles associated with the complexes and are expected to be beneficial to researchers employing spectroscopic methods to investigate the mechanisms of energy transfer between the pigments bound in these complexes.     

Analysis of teleost hemoglobin by Adair and Monod-Wyman-Changeux models

Summary The allosteric effects of the erythrocytic nucleoside triphosphates (NTP) and of proton concentrations were investigated by precise measurement of Hb–O₂ equilibria of tench hemoglobin (including extreme, high and low saturation ranges) and analysed in terms of the MWC two state model and the Adair four step oxygenation theory.At low concentrations (NTP/Hb ratio=1.0, and pH>7.3) ATP, GTP and protons decrease Hb–O₂ affinity by increasing the allosteric constantL and reducingK _T, the association constant¹ of the deoxy, tense state of the Hb, without significantly affecting that (K _R) of the oxy state, increasing the free energy of cooperativity (G). High concentrations of these effectors, however, also reduceK _R. The greater sensitivity of the half-saturation O₂ tension (P ₅₀) of the Hb to GTP than to ATP at the same concentration, correlates with greater effects of GTP on bothK _T andK _R. The pH and NTP dependence of the four Adair association constants and the calculated fractional populations of Hb molecules in different stages of oxygenation show that the autochthonous NTP effectors and protons stabilize the T structure and postpone the TR transition basic to cooperativity in fish Hb.The possible implications of the findings for aquatic respiration are discussed.Abbreviations ATP adenosine triphosphate - DPG 2,3-diphosphoglycerate (glycerate-2,3-bisphosphate) - GTP guanosine triphosphate - IHP inositol hexaphosphate - NTP nucleoside triphosphates In this paperK _T andK _R are defined as theassociation equilibrium constants instead of dissociation constants (as originally defined by Monod et al. 1965) to facilitate comparison with the Adair constants     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Influence of carbon sources on the viability and resuscitation of Acetobacter senegalensis during high-temperature gluconic acid fermentation

Much research has been conducted about different types of fermentation at high temperature, but only a few of them have studied cell viability changes during high-temperature fermentation. In this study, Acetobacter senegalensis, a thermo-tolerant strain, was used for gluconic acid production at 38 °C. The influences of different carbon sources and physicochemical conditions on cell viability and the resuscitation of viable but nonculturable (VBNC) cells formed during fermentation were studied. Based on the obtained results, A. senegalensis could oxidize 95 g l^− 1 glucose to gluconate at 38 °C (pH 5.5, yield 83%). However, despite the availability of carbon and nitrogen sources, the specific rates of glucose consumption (q_s) and gluconate production (q_p) reduced progressively. Interestingly, gradual q_s and q_p reduction coincided with gradual decrease in cellular dehydrogenase activity, cell envelope integrity, and cell culturability as well as with the formation of VBNC cells. Entry of cells into VBNC state during stationary phase partly stemmed from high fermentation temperature and long-term oxidation of glucose, because just about 48% of VBNC cells formed during stationary phase were resuscitated by supplementing the culture medium with an alternative favorite carbon source (low concentration of ethanol) and/or reducing incubation temperature to 30 °C. This indicates that ethanol, as a favorable carbon source, supports the repair of stressed cells. Since formation of VBNC cells is often inevitable during high-temperature fermentation, using an alternative carbon source together with changing physicochemical conditions may enable the resuscitation of VBNC cells and their use for several production cycles.

     

Competition for Ammonium between Nitrifying and Heterotrophic Bacteria in Dual Energy-Limited Chemostats

The absence of nitrification in soils rich in organic matter has often been reported. Therefore, competition for limiting amounts of ammonium between the chemolithotrophic ammonium-oxidizing species Nitrosomonas europaea and the heterotrophic species Arthrobacter globiformis was studied in the presence of Nitrobacter winogradskyi in continuous cultures at dilution rates of 0.004 and 0.01 h⁻¹. Ammonium limitation of A. globiformis was achieved by increasing the glucose concentration in the reservoir stepwise from 0 to 5 mM while maintaining the ammonium concentration at 2 mM. The numbers of N. europaea and N. winogradskyi cells decreased as the numbers of heterotrophic bacteria rose with increasing glucose concentrations for both dilution rates. Critical carbon-to-nitrogen ratios of 11.6 and 9.6 were determined for the dilution rates of 0.004 and 0.01 h⁻¹, respectively. Below these critical values, coexistence of the competing species was found in steady-state situations. Although the numbers were strongly reduced, the nitrifying bacteria were not fully outcompeted by the heterotrophic bacteria above the critical carbon-to-nitrogen ratios. Nitrifying bacteria could probably maintain themselves in the system above the critical carbon-to-nitrogen ratios because they are attached to the glass wall of the culture vessels. The numbers of N. europaea decreased more than did those of N. winogradskyi. This was assumed to be due to heterotrophic growth of the latter species on organic substrates excreted by the heterotrophic bacteria.