Evidence for top predator control of a grazing ecosystem

The importance of top predators in controlling ecological processes in large, intact ecosystems is unclear. In grasslands that support abundant ungulates, top–down control by predators may be particularly important, because of the tight biogeochemical linkages of ungulate prey with plants and soil microbes. Here, I examined the effects of the recent reintroduction of the gray wolf Canis lupus on ecosystem processes in Yellowstone National Park, where herds of grazing ungulates previously have been shown to stimulate several processes, including soil net nitrogen (N) mineralization. Rates of ungulate grazing intensity and soil net N mineralization were compared before and after wolf reintroduction in grasslands ranging five‐fold in aboveground production. Grazing intensity and grassland net N mineralization declined after wolf reintroduction, a likely partial function of fewer ungulates; wolf predation has been one of several factors implicated in causing the decline in Yellowstone ungulates. In addition, the spatial pattern of grazing and net N mineralization changed after reintroduction. A shift in the spatial patterns of grazer‐associated processes is consistent with a growing body of work indicating that wolves have changed habitat use patterns of ungulates in Yellowstone National Park. These findings suggest widespread wolf effects on ungulate prey, plants, and microbial activity that have spatially reorganized grassland energy and nutrient dynamics in Yellowstone Park.     

Growth inhibition of putrefactive anaerobe 3679 caused by stringent-type response induced by protonophoric activity of sorbic acid

The inhibitory effects of potassium sorbate on the bioenergetics, phenylalanine uptake, protein synthesis, and certain aspects of cell regulation were examined in putrefactive anaerobe 3679. Undissociated sorbic acid appeared to act as a protonophore by lowering the intracellular pH and dissipating the proton motive force of the membrane. Sorbate inhibited the uptake of phenylalanine, decreased the rate of protein synthesis, and altered patterns of phosphorylated nucleotide accumulation, resulting in increased intracellular concentrations of GTP, ppGpp, and an unidentified compound (possibly pppGpp). The addition of a noninhibitory amount of tetracycline released the inhibition of growth by sorbate. Based on these results, we concluded that the inhibition of putrefactive anaerobe 3679 by sorbate resulted from a stringent-type regulatory response induced by the protonophoric activity of sorbic acid.     

Mercury in blood cells—Altered elemental profiles

The study was composed of 27 persons that displayed vague symptoms similar to those of the victims of Minamata and Iraq. Skew distributions of mercury were observed in individual erythrocytes and neutrophil granulocytes when measured by PIXE. Mercury could not be detected in the platelets. The erythrocytes also displayed lowered concentrations of magnesium and zinc, together with increased concentrations of calcium and strontium. The neutrophils displayed decreased concentrations of magnesium and zinc and increased concentrations of calcium, strontium, and iron. The presence of mercury and the altered elemental profiles in the erythrocytes and the neutrophil granulocytes are suggested as early signs of exposure.     

Lipid bilayer polypeptide interactions studied by molecular dynamics simulation

A model membrane with a polypeptide alpha-helix inserted has been simulated by molecular dynamics at a temperature well above the gel/liquid crystalline phase transition temperature. Order parameters of the lipids and other equilibrium and dynamic quantities have been calculated. Three systems, polyglycine constrained into an alphahelical configuration, glycophorin with similarly conformationally constrained backbone and finally glycophorin free to change its backbone conformation, have been studied. In all cases there was an ordering of the chains close to the helix. This effect was, however, much smaller for glycophorin with its rather bulky side chains than for polyglycine. The dynamics of the lipids were affected by the neighbouring helix, not drastically however. Lateral diffusion and reorientational time correlations of lipids close to the helix were slower than for the bulk ones, but not more than two or three times. Thus, we did not find any evidence of bound or frozen boundary lipids.     

Analysis of teleost hemoglobin by Adair and Monod-Wyman-Changeux models

Summary The allosteric effects of the erythrocytic nucleoside triphosphates (NTP) and of proton concentrations were investigated by precise measurement of Hb–O₂ equilibria of tench hemoglobin (including extreme, high and low saturation ranges) and analysed in terms of the MWC two state model and the Adair four step oxygenation theory.At low concentrations (NTP/Hb ratio=1.0, and pH>7.3) ATP, GTP and protons decrease Hb–O₂ affinity by increasing the allosteric constantL and reducingK _T, the association constant¹ of the deoxy, tense state of the Hb, without significantly affecting that (K _R) of the oxy state, increasing the free energy of cooperativity (G). High concentrations of these effectors, however, also reduceK _R. The greater sensitivity of the half-saturation O₂ tension (P ₅₀) of the Hb to GTP than to ATP at the same concentration, correlates with greater effects of GTP on bothK _T andK _R. The pH and NTP dependence of the four Adair association constants and the calculated fractional populations of Hb molecules in different stages of oxygenation show that the autochthonous NTP effectors and protons stabilize the T structure and postpone the TR transition basic to cooperativity in fish Hb.The possible implications of the findings for aquatic respiration are discussed.Abbreviations ATP adenosine triphosphate - DPG 2,3-diphosphoglycerate (glycerate-2,3-bisphosphate) - GTP guanosine triphosphate - IHP inositol hexaphosphate - NTP nucleoside triphosphates In this paperK _T andK _R are defined as theassociation equilibrium constants instead of dissociation constants (as originally defined by Monod et al. 1965) to facilitate comparison with the Adair constants     

Influences of exercise-stress and adrenaline upon intra- and extracellular acid-base status,electrolyte composition and respiratory properties of blood in tench (Tinca tinca) at different seasons

Summary Exercise-stress in tench resulted in severe acidoses in both the red cells and the extracellular fluid in vivo. These coincident pH decreases conformed to the in vitro pH_i-pH_e relationship for tench blood in the oxygenated state. The extracellular acidosis was primarily respiratory in winter and metabolic in spring and summer. This was due to more effective buffering of metabolic protons in winter by an elevation in [HCO ₃ ^– ] levels, rather than to differences in the lactic- and carbonic acid loads. A good correspondence was found between buffered metabolic protons and increases in [lactate].There was no evidence for -adrenergic red cell swelling and associated red cell pH changes in tench both after exercise and adrenaline infusion. Arterial O₂ transport was, however, improved in exercise by pronounced increases in .Large increases in plasma potassium concentration and small elevations of chloride and calcium levels occurred in exercise. Hematocrit and blood [Hb] also increased, probably due to an adrenergic release of erythrocytes from the spleen, but these increases were small and appeared unimportant for blood O₂ transport.Seasonal differences were found in exercise-induced changes in [lactate], in the magnitude of electrolyte and changes, as well as in resting values for pH_e, pH_i, [HCO ₃ ^– ], [Cl^–] and [Ca⁺⁺]. The origin and importance of these are discussed.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Cartilage electromechanics--II. A continuum model of cartilage electrokinetics and correlation with experiments

We have formulated a continuum model for linear electrokinetic transduction in cartilage. Expressions are derived for the streaming potential and streaming current induced by oscillatory, uniaxial confined compression of the tissue, as well as the mechanical stress generated by a current density or potential difference applied to the tissue. The experimentally observed streaming potential and current-generated stress response, measured on the same specimens, are compared with the predictions of the theory over a wide frequency range. The theory compares well with the data for reasonable values of cartilage intrinsic mechanical parameters and electrokinetic coupling coefficients. Experiments also show a linear relationship between the stimulus amplitude and the transduction response amplitude, within the range of stimulus amplitudes of interest. This observation is shown to be consistent with the predictions of the linear theory.     

Modulation of FcR function by complement: subcomponent C1q enhances the phagocytosis of IgG-opsonized targets by human monocytes and culture-derived macrophages

We have investigated the interaction of C1q, a subunit of the first component of complement, with human monocytes and culture-derived macrophages. Adherence of these mononuclear phagocytes to surfaces coated with C1q induced a marked enhancement of the phagocytosis of sheep erythrocytes opsonized with IgG anti-Forssman antibody (EA-IgG). This C1q-mediated enhancement of phagocytosis was dose dependent, and was specifically blocked by pretreatment of the C1q-coated surfaces with F(ab')2 anti-C1q. The augmentation of FcR-mediated phagocytosis by C1q was determined to be a result of the interaction between the C1q and the phagocytic effector cell, and was not due to interaction between the surface-bound C1q and the EA-IgG. Neither resting nor N-formyl-methionyl-leucyl-phenylalanine-stimulated polymorphonuclear leukocytes were induced by C1q to increase FcR-mediated phagocytosis. Experiments conducted with purified fragments of C1q suggest that the C1q phagocytosis enhancement signal resides in the collagen-like tail domain of the molecule. This region is the same portion of the molecule previously shown to interact with the cell surface C1q receptor. Native type I collagen was unable to enhance FcR-mediated phagocytosis by mononuclear phagocytes. It has been demonstrated that C1q can be localized to areas of inflammation, and additionally C1q can be secreted by macrophages in culture. In view of these findings and the results of our present study, we hypothesize that C1q could provide local, direct, and non-opsonic enhancement of phagocytosis by mononuclear phagocytes in areas of infection and inflammation.