Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Three-dimensional structure of the large ribosomal subunit from Escherichia coli.

The three-dimensional structure of the large (50S) ribosomal subunit from Escherichia coli has been determined from electron micrographs of negatively stained specimens. A new method of three-dimensional reconstruction was used which combines many images of individual subunits recorded at a single high tilt angle. A prominent feature of the reconstruction is a large groove on the side of the subunit that interacts with the small ribosomal subunit. This feature is probably of functional significance as it includes the regions where the peptidyl transferase site and the binding locations of the elongation factors have been mapped previously by immunoelectron microscopy.     

Time dependent stimulating effect of glucagon on the capacity of urea-N synthesis in rats

The effect of glucagon on the capacity of urea-N synthesis was examined in 24 rats as a function of time. First, the conditions for saturation of urea synthesis under glucagon influence were studied by the kinetics of urea-N synthesis rate in relation to arterial blood alpha-amino-N concentration between 5 and 17 mmol/l in 21 nephrectomized rats given zinc-glucagon (20 micrograms s.c. per day) for 14 days. Alanine was infused so that steady state concentrations of total alpha-amino-N was attained in each rat. The urea-N synthesis rate was calculated as accumulation in total body water corrected for intestinal hydrolysis. The relationship suggested a barrier limited substrate inhibition kinetics, as earlier found in control rats, and data were examined accordingly by non-linear regression analysis. The estimated kinetic constants were: Vmax = 71 mumol/(min X 100 g body wt), Km = 5.4 mmol/l, Ki = 2.4 mmol/l, and the barrier = 4.4 mmol/l. Vmax was increased three times compared with controls. The capacity of urea-N synthesis, i.e. the zenith of the relation, was attained in the concentration interval 7.5 to 12.0 mmol/l, as in controls. The capacity of urea-N synthesis was determined during i.v. infusion of zinc-glucagon (0.15 microgram per min) and after 2, 8, and 14 days of daily s.c. injections of 20 micrograms zinc-glucagon. Rats given zinc-protamine solution were controls.(ABSTRACT TRUNCATED AT 250 WORDS)     

Membrane glycoproteins involved in neurite fasciculation

Lectin affinity chromatography combined with mAb production was used to identify chick neural cell surface molecules related to L1 antigen, a mouse neural glycoprotein implicated in cell-cell adhesion (Rathjen, F. G., and M. Schachner, 1984, EMBO (Eur. Mol. Biol. Organ.) J., 3:1-10). A glycoprotein, G4 antigen, isolated by mAb G4 from adult chick brain is described which comprises a major 135-kD component, a minor doublet at 190 kD, and diffusely migrating bands at 80 and 65 kD in SDS PAGE. This molecule is structurally related to mouse L1 antigen according to NH2-terminal amino acid sequence (50% identity) as well as the behavior of its components in two-dimensional IEF/SDS PAGE gels. A second chicken glycoprotein, F11 antigen, was isolated from adult chick brain using mAb F11. This protein has also a major 135-kD component and minor components at 170 kD and 120 kD. Both immunotransfer analysis with polyclonal antibodies to mAb G4 and to mAb F11 isolate and the behavior on IEF/SDS PAGE gels indicates that the major 135-kD component of F11 antigen is distinct from G4 antigen components. However, the 135-kD component of F11 antigen shares with G4 antigen and the neural cell adhesion molecule (NCAM) the HNK-1/L2 carbohydrate epitope. In immunofluorescence studies, G4 and F11 antigenic sites were found to be associated mainly with the surface of process-bearing cells, particularly in fiber-rich regions of embryonic brain. Although Fab fragments of polyclonal antibodies to mAbs G4 or F11 immunoaffinity isolate only weakly inhibit the Ca2+-independent aggregation of neural cells, they strongly inhibit fasciculation of retinal axons. Together these studies extend the evidence that bundling of axons reflects the combined effects of a group of distinct cell surface glycoproteins.     

Cartilage electromechanics--II. A continuum model of cartilage electrokinetics and correlation with experiments

We have formulated a continuum model for linear electrokinetic transduction in cartilage. Expressions are derived for the streaming potential and streaming current induced by oscillatory, uniaxial confined compression of the tissue, as well as the mechanical stress generated by a current density or potential difference applied to the tissue. The experimentally observed streaming potential and current-generated stress response, measured on the same specimens, are compared with the predictions of the theory over a wide frequency range. The theory compares well with the data for reasonable values of cartilage intrinsic mechanical parameters and electrokinetic coupling coefficients. Experiments also show a linear relationship between the stimulus amplitude and the transduction response amplitude, within the range of stimulus amplitudes of interest. This observation is shown to be consistent with the predictions of the linear theory.     

Modulation of FcR function by complement: subcomponent C1q enhances the phagocytosis of IgG-opsonized targets by human monocytes and culture-derived macrophages

We have investigated the interaction of C1q, a subunit of the first component of complement, with human monocytes and culture-derived macrophages. Adherence of these mononuclear phagocytes to surfaces coated with C1q induced a marked enhancement of the phagocytosis of sheep erythrocytes opsonized with IgG anti-Forssman antibody (EA-IgG). This C1q-mediated enhancement of phagocytosis was dose dependent, and was specifically blocked by pretreatment of the C1q-coated surfaces with F(ab')2 anti-C1q. The augmentation of FcR-mediated phagocytosis by C1q was determined to be a result of the interaction between the C1q and the phagocytic effector cell, and was not due to interaction between the surface-bound C1q and the EA-IgG. Neither resting nor N-formyl-methionyl-leucyl-phenylalanine-stimulated polymorphonuclear leukocytes were induced by C1q to increase FcR-mediated phagocytosis. Experiments conducted with purified fragments of C1q suggest that the C1q phagocytosis enhancement signal resides in the collagen-like tail domain of the molecule. This region is the same portion of the molecule previously shown to interact with the cell surface C1q receptor. Native type I collagen was unable to enhance FcR-mediated phagocytosis by mononuclear phagocytes. It has been demonstrated that C1q can be localized to areas of inflammation, and additionally C1q can be secreted by macrophages in culture. In view of these findings and the results of our present study, we hypothesize that C1q could provide local, direct, and non-opsonic enhancement of phagocytosis by mononuclear phagocytes in areas of infection and inflammation.     

C5a induction of human interleukin 1. Synergistic effect with endotoxin or interferon-gamma

Interleukin-1 (IL-1) is a potent cytokine which possesses the ability to mediate systemic acute phase responses as well as local tissue inflammation. In these studies, we have examined the ability of C5a and C5a des Arg to induce IL-1 production in vitro. Human C5a and C5a des Arg were purified to homogeneity and were found to stimulate IL-1 release from freshly obtained human mononuclear cells into the extracellular medium. Only 2 hr of exposure to the purified complement components were necessary in order to stimulate IL-1 production. The minimal concentration of C5a required was 25 ng/ml, whereas 125 ng/ml of C5a des Arg induced comparable amounts of IL-1. This dose relationship was maintained at higher concentrations (150 ng/ml vs 750 ng/ml, respectively). That the effect was due to the anaphylatoxins themselves, and not endotoxin contamination, was shown by negative Limulus amebocyte lysate tests and employing preincubation of C5a/C5a des Arg with polymyxin B. The latter blocked a wide dose range of endotoxin-stimulated IL-1 production. However, when endotoxin was added to C5a or C5a des Arg, significant synergism in the stimulation of IL-1 production was observed, occurring at various concentrations of either agent. A similar synergism with C5a/C5a des Arg was seen with interferon-gamma. In these studies, IL-1 production was measured by bioassay employing cloned D . 10 . G4 . 1 murine T cells and by radioimmunoassay for human IL-1 beta; using C5a/C5a des Arg as stimulants, there was a high degree of correlation (r = 0.82) between the two assays. Since traumatic, infectious, and inflammatory diseases may result in the simultaneous appearance of these stimuli, the synergism described herein is likely to be clinically relevant.     

HLA-DP and HLA-DO genes in presumptive HLA-identical siblings: structural and functional identification of allelic variation

We analyzed HLA class II genomic polymorphisms in three families in which bone marrow transplantation was performed between individuals presumed to be HLA identical, but in which unexplained mixed lymphocyte culture reactivity was observed. These families were characterized by classical HLA serology, MLC, and DP typing. In each family, a pair of "HLA-identical" siblings demonstrated a small proliferative response in bidirectional MLC. Southern blotting analysis performed with cDNA probes for DQ alpha, DP alpha, and DP beta identified DP genomic differences in each case. Hybridization of Bgl II-digested genomic DNA with a DP alpha cDNA probe revealed three prominent polymorphic fragments (7.7, 5.8, and 3.7 kb), which discriminated between presumptive identical siblings and indicated crossover events within HLA. Similarly, hybridization of SstI-digested genomic DNA with a DP beta cDNA probe, although resulting in a more complex pattern, identified DP genomic disparity between the presumed HLA identical siblings. Hybridization of SstI-digested DNA from two families with evidence of DP recombination was performed by using an oligonucleotide probe specific for the newly described HLA class II gene DO beta. Two major polymorphic fragments, at 6.2 and 3.3 kb, segregated in these families and localized the crossovers flanking the DO beta gene between the DQ and DP loci. The contribution of the antigenic differences marked by these HLA DP and DO DNA polymorphisms to allorecognition in MLR and in graft-vs-host disease are discussed.     

The interaction of the xid and me genes

The murine "motheaten" (me) mutation has been bred onto the NFS background and combined with the X-linked immunodeficiency (xid) mutation to investigate the effect of the xid-induced B cell maturational block on the widespread immune dysfunction, high levels of autoantibodies, and early mortality found in the motheaten mice. The xid markedly reduced spontaneous IgM secretion by spleen cells, serum IgM, anti-ssDNA antibodies, anti-bromelain-treated-erythrocyte antibodies, and T cell binding (but not thymocytotoxic) antibodies; however, neither phenotype nor mortality was affected, suggesting that other factors are responsible for early death. Marked expansion of the Ly-1+ B cell pool was prevented by xid in the motheaten mouse leaving only a very small population of sIgM-positive B cells. This failure of non-Ly-1+ B cell development in me/me X xid mice suggests that me/me leads to inhibition of non-Ly-1+ B cells and preferential expansion of Ly-1+ B cells in motheaten mice, perhaps as a result of their high levels of maturation and activation factors.     

Structural analysis of an HLA-B27 population variant, B27f. Multiple patterns of amino acid changes within a single polypeptide segment generate polymorphism in HLA-B27

The structure of a new HLA-B27 variant, B27f, distinguishable from other HLA-B27 subtypes by isoelectric focusing and serologic criteria, has been established by comparative peptide mapping and radiochemical sequence analysis. HLA-B27f differs from the major B27.1 subtype in three clustered amino acid replacements: Asp74, Asp77, and Leu81 in B27.1 are changed to Tyr74, Asn77, and Ala81, respectively in B27f. This pattern of differences is analogous to that of HLA-B27.2 in that this subtype also differs from B27.1 in multiple clustered substitutions within the same segment. Thus, polymorphism within the HLA-B27 system is being achieved by introducing different sets of amino acid changes within a particular short segment of the alpha 1 domain. The most likely mechanism for the introduction of multiple changes within this segment is a nonreciprocal recombination event, such as gene conversion. The structural analogies and ethnic distribution of B27f and B27.2 as compared with those of B27.3, and B27.4 support a dynamic model of HLA-B27 evolution in which polymorphism has been created after the separation of the major ethnic groups. In this model, a Caucasian branch would be characterized by subtypes differing from B27.1 in a few changes within the alpha 1 domain, which were probably generated by single genetic steps. An Oriental branch would include those subtypes which differ from B27.1 by changes in both alpha 1 and alpha 2, involving multiple genetic steps for their generation.