Relationships between the effects of insect herbivory and sheep grazing on seasonal changes in an early successional plant community

Summary The effects of spring grazing by sheep and of natural levels of insect herbivory were studied in 1985 on a limestone field abandoned from arable land for four years. A split-plot design was adopted in which paddocks, arranged in Latin squares, were either left ungrazed or heavily grazed by sheep for ten days in April. Within each paddock plots were either sprayed regularly with Malathion-60 or untreated.Natural levels of insect herbivory, compared to the reduced levels in insecticide-treated plots, had effects of similar magnitude to those from the short burst of spring grazing. Many attributes of the grazed/insecticide-treated sward were either increased or decreased by a factor of two within a season. Both types of herbivore caused changes in the direction of plant succession as well as in its rate. Effects on early successional species were large and similar when caused by either type of herbivore. Effects on later successional species were often smaller, but also showed differences in the action of the two herbivore types, as did effects on sward height, species richness and total cover. The effects of sheep and insect herbivory were not always additive or in the same direction.The results suggest that manipulations of both mammal and insect herbivores may be powerful tools for directing changes in plant community composition.     

Serum and urine chromium as indices of chromium status in tannery workers

Serum and urinary Cr levels of a selected group of men exposed to CrIII in four Southern Ontario tanneries were compared with those of men not exposed to Cr. Fasted blood samples were obtained from 72 tannery workers (TW; mean age +/- SD = 36 +/- 12 years) and from 52 controls (CS; mean age +/- SD = 41 +/- 13 years). Serum Cr levels as determined by graphite furnace atomic absorption spectrophotometry were significantly higher (P = 0.0001) for TW (median 0.49 ng/ml, range 0.37-0.81) than for CS (median 0.15 ng/ml, range 0.12-0.20). Urine samples were collected from 49 TW and 43 CS on a Friday pm and from 42 TW on a Monday am. Urinary creatine (Cre) was determined by the Jaffe reaction. For Friday samples, the median urinary Cr/Cre ratio was significantly higher (P = 0.0001) for TW (median 0.83 ng/mg, range 0.48-1.82) than for CS (median 0.18 ng/mg, range 0.13-0.26). For TW, Cr/Cre was correlated with serum Cr (r = 0.72, P = 0.0001). Neither urinary Cr/Cre nor serum Cr was correlated with length of employment in the tanning industry. There were significant differences in serum Cr levels and urinary Cr/Cre ratios among TW employed in different areas of the tanneries. For TW, the median urinary Cr/Cre ratio for Monday morning samples was significantly lower than for Friday afternoon samples (P = 0.03). These data indicate that CrIII is absorbed and that serum and urine Cr in tannery workers may be indices of Cr exposure and status.     

OmpR and EnvZ are pleiotropic regulatory proteins: positive regulation of the tripeptide permease (tppB) of Salmonella typhimurium

Summary The tppB locus of Salmonella typhimurium encodes the anaerobically-induced tripeptide permease. We have demonstrated that expression of tppB requires the function of the ompR and envZ gene products, originally identified as positive regulatory proteins required for the osmotic regulation of porin expression. Significantly, tppB expression is not osmotically regulated. We have also identified three additional genes whose expression depends on OmpR. Thus OmpR and EnvZ serve a more general regulatory role than has previously been supposed. This study provides the first detailed genetic analysis of the ompB locus of S. typhimurium.     

Plant responses to H2S and SO2 fumigation. I. Effects on growth, transpiration and sulfur content of spinach

Exposure of spinach (Spinacia oleracea L. cv. Monosa) to 0.25 μl l_?1 H₂S reduced the relative growth rate by 26, 47 and 60% at 15, 18 and 25°C, respectively. Shoot to root ratio decreased in plants fumigated at 18 and 25°C. Growth of spinach was not affected by a 2-week exposure to 0.10 or 0.25 μl l_?1 SO₂. Both H₂S and SO₂ fumigation increased the content of sulfhydryl compounds and sulfate. A 2-week exposure to 0.25 μl l_?1 H₂S resulted in an increase in sulfhydryl and sulfate content of 250 to 450% and 63 to 248% in the shoots, respectively, depending on growth temperature. Exposure to 0.15 and 0.30 μl l_?1 H₂S at 20°C for 2 weeks resulted in a 46% increase in sulfate content of the shoots at 0.30 μl l_?1 and no detectable increase at 0.15 μl l_?1 H₂S; the sulfate content of the roots increased by 195 and 145% at 0.15 and 0.30 μl l_?1 H₂S, respectively. Fumigation with 0.25 μl l_?1 SO₂ at 20°C for 2 weeks resulted in an increase in sulfhydryl content and sulfate content in the shoots of 285% and 300 to 1100%. H₂S fumigation during the 12 h light period or only during the dark period resulted in identical growth reduction and accumulation of sulfhydryl compounds; they were about 50 and 67% of those observed in continuously exposed plants. H₂S- and SO₂-exposed plants showed an increased transpiration rate, which was mainly caused by an increased dark-period transpiration. No effect of H₂S and SO₂ on the water uptake of the plants and the osmotic potential of the leaves was detected. Plants fumigated with 0.25 μl l_?1 H₂S for 2 weeks were smaller and differed morphologically from the control plants by slightly more abaxially curved leaf margins. Cross sections of the leaves showed smaller cells at the margins and smaller and fewer air spaces. The increased transpiration in the H₂S-exposed plants is discussed in relation to the observed morphological changes.     

Site-directed mutagenesis to determine essential residues of ribulose-bisphosphate carboxylase ofRhodospirillum rubrum

Both Lys-166 and His-291 of ribulosebisphosphate carboxylase/oxygenase fromRhodospirillum rubrum have been implicated as the active-site residue that initiates catalysis. To decide between these two candidates, we resorted to site-directed mutagenesis to replace Lys-166 and His-291 with several amino acids. All 7 of the position-166 mutants tested are severely deficient in carboxylase activity, whereas the alanine and serine mutants at position 291 are ∼40% and ∼18% as active as the native carboxylase, essentially ruling out His-291 in theRhodospirillum rubrum carboxylase (and by inference His-298 in the spinach enzyme) as a catalytically essential residue. The ability of some of the mutant proteins to undergo carbamate formation or to bind either ribulosebisphosphate or a transition-state analogue remains largely unimpaired. This implies that Lys-166 is not required for substrate binding; rather, the results corroborate the earlier postulate that Lys-166 functions as an acid-base group in catalysis or in stabilizing a transition state in the reaction pathway.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Three-dimensional structure of the large ribosomal subunit from Escherichia coli.

The three-dimensional structure of the large (50S) ribosomal subunit from Escherichia coli has been determined from electron micrographs of negatively stained specimens. A new method of three-dimensional reconstruction was used which combines many images of individual subunits recorded at a single high tilt angle. A prominent feature of the reconstruction is a large groove on the side of the subunit that interacts with the small ribosomal subunit. This feature is probably of functional significance as it includes the regions where the peptidyl transferase site and the binding locations of the elongation factors have been mapped previously by immunoelectron microscopy.     

Human N-acetylgalactosamine-4-sulphate sulphatase. Purification, monoclonal antibody production and native and subunit Mr values.

Initial purification of N-acetylgalactosamine-4-sulphate sulphatase from human liver homogenates containing approx. 1 mg of enzyme in 26 g of soluble proteins was achieved by a six-column chromatography procedure and yielded approx. 40 micrograms of a single major protein species. Enzyme thus prepared was used to produce N-acetylgalactosamine-4-sulphate sulphatase-specific monoclonal antibodies. The use of a monoclonal antibody linked to a solid support facilitated the purification of approx. 0.5 mg of N-acetylgalactosamine-4-sulphate sulphatase from a similar liver homogenate. Moreover the enzyme isolated contained a single protein species, shown by SDS/polyacrylamide-gel electrophoresis to have an Mr of 57,000, which dissociated into subunits of Mr 43,000 and 13,000 in the presence of reducing agents. Essentially identical enzyme preparations were isolated from homogenates of human kidney and lung and from concentrated human urine. The native protein Mr of enzyme from human liver and kidney was assessed by gel-permeation chromatography to be 43,000 on Ultrogel AcA and Bio-Gel P-150. The liver N-acetylgalactosamine-4-sulphate sulphatase was shown to have pH optima of approx. 4 and 5.5 with the oligosaccharide substrate (GalNAc4S-GlcA-GalitolNAc4S) and fluorogenic substrate (methylumbelliferyl sulphate) respectively. Km values of 60 microM and 4 mM and Vmax. values of 2 and 20 mumol/min per mg were determined with the oligosaccharide and fluorogenic substrates respectively.