Plant responses to H2S and SO2 fumigation. I. Effects on growth, transpiration and sulfur content of spinach

Exposure of spinach (Spinacia oleracea L. cv. Monosa) to 0.25 μl l_?1 H₂S reduced the relative growth rate by 26, 47 and 60% at 15, 18 and 25°C, respectively. Shoot to root ratio decreased in plants fumigated at 18 and 25°C. Growth of spinach was not affected by a 2-week exposure to 0.10 or 0.25 μl l_?1 SO₂. Both H₂S and SO₂ fumigation increased the content of sulfhydryl compounds and sulfate. A 2-week exposure to 0.25 μl l_?1 H₂S resulted in an increase in sulfhydryl and sulfate content of 250 to 450% and 63 to 248% in the shoots, respectively, depending on growth temperature. Exposure to 0.15 and 0.30 μl l_?1 H₂S at 20°C for 2 weeks resulted in a 46% increase in sulfate content of the shoots at 0.30 μl l_?1 and no detectable increase at 0.15 μl l_?1 H₂S; the sulfate content of the roots increased by 195 and 145% at 0.15 and 0.30 μl l_?1 H₂S, respectively. Fumigation with 0.25 μl l_?1 SO₂ at 20°C for 2 weeks resulted in an increase in sulfhydryl content and sulfate content in the shoots of 285% and 300 to 1100%. H₂S fumigation during the 12 h light period or only during the dark period resulted in identical growth reduction and accumulation of sulfhydryl compounds; they were about 50 and 67% of those observed in continuously exposed plants. H₂S- and SO₂-exposed plants showed an increased transpiration rate, which was mainly caused by an increased dark-period transpiration. No effect of H₂S and SO₂ on the water uptake of the plants and the osmotic potential of the leaves was detected. Plants fumigated with 0.25 μl l_?1 H₂S for 2 weeks were smaller and differed morphologically from the control plants by slightly more abaxially curved leaf margins. Cross sections of the leaves showed smaller cells at the margins and smaller and fewer air spaces. The increased transpiration in the H₂S-exposed plants is discussed in relation to the observed morphological changes.     

Site-directed mutagenesis to determine essential residues of ribulose-bisphosphate carboxylase ofRhodospirillum rubrum

Both Lys-166 and His-291 of ribulosebisphosphate carboxylase/oxygenase fromRhodospirillum rubrum have been implicated as the active-site residue that initiates catalysis. To decide between these two candidates, we resorted to site-directed mutagenesis to replace Lys-166 and His-291 with several amino acids. All 7 of the position-166 mutants tested are severely deficient in carboxylase activity, whereas the alanine and serine mutants at position 291 are ∼40% and ∼18% as active as the native carboxylase, essentially ruling out His-291 in theRhodospirillum rubrum carboxylase (and by inference His-298 in the spinach enzyme) as a catalytically essential residue. The ability of some of the mutant proteins to undergo carbamate formation or to bind either ribulosebisphosphate or a transition-state analogue remains largely unimpaired. This implies that Lys-166 is not required for substrate binding; rather, the results corroborate the earlier postulate that Lys-166 functions as an acid-base group in catalysis or in stabilizing a transition state in the reaction pathway.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Three-dimensional structure of the large ribosomal subunit from Escherichia coli.

The three-dimensional structure of the large (50S) ribosomal subunit from Escherichia coli has been determined from electron micrographs of negatively stained specimens. A new method of three-dimensional reconstruction was used which combines many images of individual subunits recorded at a single high tilt angle. A prominent feature of the reconstruction is a large groove on the side of the subunit that interacts with the small ribosomal subunit. This feature is probably of functional significance as it includes the regions where the peptidyl transferase site and the binding locations of the elongation factors have been mapped previously by immunoelectron microscopy.     

Vitellogenin mRNA in locust fat body: coordinate induction of two genes by a juvenile hormone analog

Levels of vitellogenin (Vg) mRNA in Locusta migratoria fat body were determined as indicators of gene expression induced by the juvenile hormone analog methoprene. After injection of methoprene into juvenile hormone-deprived locusts, excised fat bodies were cultured with [3H]leucine for immunochemical assay of Vg synthesis, and RNA was assayed for Vg mRNA content by hybridization with probes from the previously cloned locust Vg genes A and B. In general, the rise in Vg mRNA paralleled the rise in Vg synthesis. During the primary response to methoprene (in female locusts in which the corpora allata had been destroyed immediately after emergence), Vg mRNA was first detected after 18-24 hr and accumulated rapidly between 36 and 48 hr. The secondary response (in locusts allatectomized during vitellogenesis and kept until Vg disappeared) was accelerated, as Vg mRNA was detectable at 12 hr and titers rose steeply after 18 hr. When Vg synthesis was prematurely induced by injection of methoprene into fifth-stage female larvae, the kinetics of mRNA accumulation were similar to those of primary stimulation in the adult. After allatectomy of vitellogenic females, fat body Vg mRNA decayed with a half-life of about 24 hr, roughly paralleling the decline in Vg synthesis. Assays with the two Vg probes showed coordinate accumulation of gene A and gene B messages under all conditions tested: during primary and secondary stimulation in adult females and in the low-level response obtained by treating male larvae with methoprene.     

The major histocompatibility complex of primates

The major histocompatibility complex (MHC) encodes cell surface glycoproteins that function in self-nonself recognition and in allograft rejection. Among primates, the MHC has been well defined only in the human; in the chimpanzee and in two species of macaque monkeys the MHC is less well characterized. Serologic, biochemical and genetic evidence indicates that the basic organization of the MHC linkage group has been phylogenetically conserved. However, the number of genes and their linear relationship on the chromosomes differ between species. Class I MHC loci encode molecules that are the most polymorphic genes known. These molecules are ubiquitous in their tissue distribution and typically are recognized together with nominal antigens by cytotoxic lymphocytes. Class II MHC loci constitute a smaller family of serotypes serving as restricting elements for regulatory T lymphocytes. The distribution of class II antigens is limited mainly to cell types serving immune functions, and their expression is subject to up and down modulation. Class III loci code for components C2, C4 and Factor B (Bf) of the complement system.Interspecies differences in the extent of polymorphism occur, but the significance of this finding in relation to fitness and natural selection is unclear. Detailed information on the structure and regulation of MHC gene expression will be required to understand fully the biologic role of the MHC and the evolutionary relationships between species. Meanwhile, MHC testing has numerous applications to biomedical research, especially in preclinical tissue and organ transplantation studies, the study of disease mechanisms, parentage determination and breeding colony management. In this review, the current status of MHC definition in nonhuman primates will be summarized. Special emphasis is placed on the CyLA system of M. fascicularis which is a major focus in our laboratory. A highly polymorphic cynomolgus MHC has been partially characterized and consists of at least 14 A locus, 11 B locus, 7 C locus class I allelic specificities, 9 Ia-like class II antigens and 6 Bf (class III) variants.     

Characterization of the specific pyruvate transport system in Escherichia coli K-12.

A mutant of Escherichia coli K-12 lacking pyruvate dehydrogenase and phosphoenolpyruvate synthase was used to study the transport of pyruvate by whole cells. Uptake of pyruvate was maximal in mid-log phase cells, with a Michaelis constant for transport of 20 microM. Pretreatment of the cells with respiratory chain poisons or uncouplers, except for arsenate, inhibited transport up to 95%. Lactate and alanine were competitive inhibitors, but at nonphysiological concentrations. The synthetic analogs 3-bromopyruvate and pyruvic acid methyl ester inhibited competitively. The uptake of pyruvate was also characterized in membrane vesicles from wild-type E. coli K-12. Transport required an artificial electron donor system, phenazine methosulfate and sodium ascorbate. Pyruvate was concentrated in vesicles 7- to 10-fold over the external concentration, with a Michaelis constant of 15 microM. Energy poisons, except arsenate, inhibited the transport of pyruvate. Synthetic analogs such as 3-bromopyruvate were competitive inhibitors of transport. Lactate initially appeared to be a competitive inhibitor of pyruvate transport in vesicles, but this was a result of oxidation of lactate to pyruvate. The results indicate that uptake of pyruvate in E. coli is via a specific active transport system.     

Membrane-murein attachment at the leading edge of the division septum: a second membrane-murein structure associated with morphogenesis of the gram-negative bacterial division septum.

Electron microscopy of plasmolyzed cells of Salmonella typhimurium revealed a continuous zone of membrane-murein attachment at the leading edge of the division septum at all stages of septal invagination. The membrane-murein attachment site had a characteristic ultrastructural appearance and remained as a bacterial birth scar at the new pole of each of the two daughter cells after cell separation. The continuous zone of membrane-murein attachment at the leading septal edge represents the second organelle based on a topologically ordered domain of membrane-murein adhesion to be described at the site of cell division.