Stressful life events preceding the acute onset of schizophrenia: A cross-national study from the World Health Organization

This study reports on the findings from a WHO sponsored cross-national investigation of life events and schizophrenia. Data are presented from a series of 386 acutely ill schizophrenic patients selected from nine field research centers located in developing and developed countries (Aarhus, Denmark; Agra, India; Cali, Colombia; Chandigarh, India; Honolulu, USA; Ibadan, Nigeria; Nagasaki, Japan; Prague, Czechoslovakia; Rochester, USA). On a methodological level, the study demonstrates that life event methodologies originating in the developed countries can be adapted for international studies and may be used to collect reasonably reliable and comparable cross-cultural data on psychosocial factors affecting the course of schizophrenic disorders. Substantive findings replicate the results of prior studies which conclude that socioenvironmental stressors may precipitate schizophrenic attacks and such events tend to cluster in the two to three week period immediately preceding illness onset.The paper was prepared by these authors on behalf of the collaborating investigators listed on page 196.     

Site-directed mutagenesis to determine essential residues of ribulose-bisphosphate carboxylase ofRhodospirillum rubrum

Both Lys-166 and His-291 of ribulosebisphosphate carboxylase/oxygenase fromRhodospirillum rubrum have been implicated as the active-site residue that initiates catalysis. To decide between these two candidates, we resorted to site-directed mutagenesis to replace Lys-166 and His-291 with several amino acids. All 7 of the position-166 mutants tested are severely deficient in carboxylase activity, whereas the alanine and serine mutants at position 291 are ∼40% and ∼18% as active as the native carboxylase, essentially ruling out His-291 in theRhodospirillum rubrum carboxylase (and by inference His-298 in the spinach enzyme) as a catalytically essential residue. The ability of some of the mutant proteins to undergo carbamate formation or to bind either ribulosebisphosphate or a transition-state analogue remains largely unimpaired. This implies that Lys-166 is not required for substrate binding; rather, the results corroborate the earlier postulate that Lys-166 functions as an acid-base group in catalysis or in stabilizing a transition state in the reaction pathway.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Three-dimensional structure of the large ribosomal subunit from Escherichia coli.

The three-dimensional structure of the large (50S) ribosomal subunit from Escherichia coli has been determined from electron micrographs of negatively stained specimens. A new method of three-dimensional reconstruction was used which combines many images of individual subunits recorded at a single high tilt angle. A prominent feature of the reconstruction is a large groove on the side of the subunit that interacts with the small ribosomal subunit. This feature is probably of functional significance as it includes the regions where the peptidyl transferase site and the binding locations of the elongation factors have been mapped previously by immunoelectron microscopy.     

Size selection of latex beads by blackfly larvae (Diptera: Simuliidae) in the laboratory

In laboratory experiments, blackfly larvae collected from a lake outlet, a woodland and a meadow stream were tested for size selection of latex beads of < Ito > 100 μm diameters. 3 suspensions of varying proportions for each size category were supplied to these blackfly larvae in common experiments. Comparisons between the size frequency distributions of particles supplied and the particle compositions in the larval guts showed intra- and interspecific differences and were quantified by calculating Jacobs' electivity index. In all species selection of larger particles increased with the larger larval instars. Although there was a positive selectivity of small particles in some cases, the ingested proportion of large particles increases volumes and biomasses of gut content and may be more important for larval growth than small particles.     

Changes in the population dynamics of Keratella cochlearis (Gosse), Kellicottia longispina (Gosse) and Polyarthra vulgaris Carlin in a fertilized enclosure

The population dynamics of phytoplankton and zooplankton in a fertilized enclosure were studied from April 1977 to June 1978. During the first spring period, the rotifers Keratella cochlearis, Kellicottia longispina, and Polyarthra vulgaris were scarce. During the following spring, all three species were abundant. An attempt is made to explain these differences. Food resource competition from cladocerans, and the low food quality and possible inhibitory effects of Coccomyxa sp. were found to be the most likely factors limiting the growth of these rotifers during the first spring period.     

Membrane glycoproteins involved in neurite fasciculation

Lectin affinity chromatography combined with mAb production was used to identify chick neural cell surface molecules related to L1 antigen, a mouse neural glycoprotein implicated in cell-cell adhesion (Rathjen, F. G., and M. Schachner, 1984, EMBO (Eur. Mol. Biol. Organ.) J., 3:1-10). A glycoprotein, G4 antigen, isolated by mAb G4 from adult chick brain is described which comprises a major 135-kD component, a minor doublet at 190 kD, and diffusely migrating bands at 80 and 65 kD in SDS PAGE. This molecule is structurally related to mouse L1 antigen according to NH2-terminal amino acid sequence (50% identity) as well as the behavior of its components in two-dimensional IEF/SDS PAGE gels. A second chicken glycoprotein, F11 antigen, was isolated from adult chick brain using mAb F11. This protein has also a major 135-kD component and minor components at 170 kD and 120 kD. Both immunotransfer analysis with polyclonal antibodies to mAb G4 and to mAb F11 isolate and the behavior on IEF/SDS PAGE gels indicates that the major 135-kD component of F11 antigen is distinct from G4 antigen components. However, the 135-kD component of F11 antigen shares with G4 antigen and the neural cell adhesion molecule (NCAM) the HNK-1/L2 carbohydrate epitope. In immunofluorescence studies, G4 and F11 antigenic sites were found to be associated mainly with the surface of process-bearing cells, particularly in fiber-rich regions of embryonic brain. Although Fab fragments of polyclonal antibodies to mAbs G4 or F11 immunoaffinity isolate only weakly inhibit the Ca2+-independent aggregation of neural cells, they strongly inhibit fasciculation of retinal axons. Together these studies extend the evidence that bundling of axons reflects the combined effects of a group of distinct cell surface glycoproteins.     

Cartilage electromechanics--II. A continuum model of cartilage electrokinetics and correlation with experiments

We have formulated a continuum model for linear electrokinetic transduction in cartilage. Expressions are derived for the streaming potential and streaming current induced by oscillatory, uniaxial confined compression of the tissue, as well as the mechanical stress generated by a current density or potential difference applied to the tissue. The experimentally observed streaming potential and current-generated stress response, measured on the same specimens, are compared with the predictions of the theory over a wide frequency range. The theory compares well with the data for reasonable values of cartilage intrinsic mechanical parameters and electrokinetic coupling coefficients. Experiments also show a linear relationship between the stimulus amplitude and the transduction response amplitude, within the range of stimulus amplitudes of interest. This observation is shown to be consistent with the predictions of the linear theory.     

Modulation of FcR function by complement: subcomponent C1q enhances the phagocytosis of IgG-opsonized targets by human monocytes and culture-derived macrophages

We have investigated the interaction of C1q, a subunit of the first component of complement, with human monocytes and culture-derived macrophages. Adherence of these mononuclear phagocytes to surfaces coated with C1q induced a marked enhancement of the phagocytosis of sheep erythrocytes opsonized with IgG anti-Forssman antibody (EA-IgG). This C1q-mediated enhancement of phagocytosis was dose dependent, and was specifically blocked by pretreatment of the C1q-coated surfaces with F(ab')2 anti-C1q. The augmentation of FcR-mediated phagocytosis by C1q was determined to be a result of the interaction between the C1q and the phagocytic effector cell, and was not due to interaction between the surface-bound C1q and the EA-IgG. Neither resting nor N-formyl-methionyl-leucyl-phenylalanine-stimulated polymorphonuclear leukocytes were induced by C1q to increase FcR-mediated phagocytosis. Experiments conducted with purified fragments of C1q suggest that the C1q phagocytosis enhancement signal resides in the collagen-like tail domain of the molecule. This region is the same portion of the molecule previously shown to interact with the cell surface C1q receptor. Native type I collagen was unable to enhance FcR-mediated phagocytosis by mononuclear phagocytes. It has been demonstrated that C1q can be localized to areas of inflammation, and additionally C1q can be secreted by macrophages in culture. In view of these findings and the results of our present study, we hypothesize that C1q could provide local, direct, and non-opsonic enhancement of phagocytosis by mononuclear phagocytes in areas of infection and inflammation.