Evidence for top predator control of a grazing ecosystem

The importance of top predators in controlling ecological processes in large, intact ecosystems is unclear. In grasslands that support abundant ungulates, top–down control by predators may be particularly important, because of the tight biogeochemical linkages of ungulate prey with plants and soil microbes. Here, I examined the effects of the recent reintroduction of the gray wolf Canis lupus on ecosystem processes in Yellowstone National Park, where herds of grazing ungulates previously have been shown to stimulate several processes, including soil net nitrogen (N) mineralization. Rates of ungulate grazing intensity and soil net N mineralization were compared before and after wolf reintroduction in grasslands ranging five‐fold in aboveground production. Grazing intensity and grassland net N mineralization declined after wolf reintroduction, a likely partial function of fewer ungulates; wolf predation has been one of several factors implicated in causing the decline in Yellowstone ungulates. In addition, the spatial pattern of grazing and net N mineralization changed after reintroduction. A shift in the spatial patterns of grazer‐associated processes is consistent with a growing body of work indicating that wolves have changed habitat use patterns of ungulates in Yellowstone National Park. These findings suggest widespread wolf effects on ungulate prey, plants, and microbial activity that have spatially reorganized grassland energy and nutrient dynamics in Yellowstone Park.     

Growth inhibition of putrefactive anaerobe 3679 caused by stringent-type response induced by protonophoric activity of sorbic acid

The inhibitory effects of potassium sorbate on the bioenergetics, phenylalanine uptake, protein synthesis, and certain aspects of cell regulation were examined in putrefactive anaerobe 3679. Undissociated sorbic acid appeared to act as a protonophore by lowering the intracellular pH and dissipating the proton motive force of the membrane. Sorbate inhibited the uptake of phenylalanine, decreased the rate of protein synthesis, and altered patterns of phosphorylated nucleotide accumulation, resulting in increased intracellular concentrations of GTP, ppGpp, and an unidentified compound (possibly pppGpp). The addition of a noninhibitory amount of tetracycline released the inhibition of growth by sorbate. Based on these results, we concluded that the inhibition of putrefactive anaerobe 3679 by sorbate resulted from a stringent-type regulatory response induced by the protonophoric activity of sorbic acid.     

Analysis of teleost hemoglobin by Adair and Monod-Wyman-Changeux models

Summary The allosteric effects of the erythrocytic nucleoside triphosphates (NTP) and of proton concentrations were investigated by precise measurement of Hb–O₂ equilibria of tench hemoglobin (including extreme, high and low saturation ranges) and analysed in terms of the MWC two state model and the Adair four step oxygenation theory.At low concentrations (NTP/Hb ratio=1.0, and pH>7.3) ATP, GTP and protons decrease Hb–O₂ affinity by increasing the allosteric constantL and reducingK _T, the association constant¹ of the deoxy, tense state of the Hb, without significantly affecting that (K _R) of the oxy state, increasing the free energy of cooperativity (G). High concentrations of these effectors, however, also reduceK _R. The greater sensitivity of the half-saturation O₂ tension (P ₅₀) of the Hb to GTP than to ATP at the same concentration, correlates with greater effects of GTP on bothK _T andK _R. The pH and NTP dependence of the four Adair association constants and the calculated fractional populations of Hb molecules in different stages of oxygenation show that the autochthonous NTP effectors and protons stabilize the T structure and postpone the TR transition basic to cooperativity in fish Hb.The possible implications of the findings for aquatic respiration are discussed.Abbreviations ATP adenosine triphosphate - DPG 2,3-diphosphoglycerate (glycerate-2,3-bisphosphate) - GTP guanosine triphosphate - IHP inositol hexaphosphate - NTP nucleoside triphosphates In this paperK _T andK _R are defined as theassociation equilibrium constants instead of dissociation constants (as originally defined by Monod et al. 1965) to facilitate comparison with the Adair constants     

Influences of exercise-stress and adrenaline upon intra- and extracellular acid-base status,electrolyte composition and respiratory properties of blood in tench (Tinca tinca) at different seasons

Summary Exercise-stress in tench resulted in severe acidoses in both the red cells and the extracellular fluid in vivo. These coincident pH decreases conformed to the in vitro pH_i-pH_e relationship for tench blood in the oxygenated state. The extracellular acidosis was primarily respiratory in winter and metabolic in spring and summer. This was due to more effective buffering of metabolic protons in winter by an elevation in [HCO ₃ ^– ] levels, rather than to differences in the lactic- and carbonic acid loads. A good correspondence was found between buffered metabolic protons and increases in [lactate].There was no evidence for -adrenergic red cell swelling and associated red cell pH changes in tench both after exercise and adrenaline infusion. Arterial O₂ transport was, however, improved in exercise by pronounced increases in .Large increases in plasma potassium concentration and small elevations of chloride and calcium levels occurred in exercise. Hematocrit and blood [Hb] also increased, probably due to an adrenergic release of erythrocytes from the spleen, but these increases were small and appeared unimportant for blood O₂ transport.Seasonal differences were found in exercise-induced changes in [lactate], in the magnitude of electrolyte and changes, as well as in resting values for pH_e, pH_i, [HCO ₃ ^– ], [Cl^–] and [Ca⁺⁺]. The origin and importance of these are discussed.     

Plant responses to H2S and SO2 fumigation. I. Effects on growth, transpiration and sulfur content of spinach

Exposure of spinach (Spinacia oleracea L. cv. Monosa) to 0.25 μl l_?1 H₂S reduced the relative growth rate by 26, 47 and 60% at 15, 18 and 25°C, respectively. Shoot to root ratio decreased in plants fumigated at 18 and 25°C. Growth of spinach was not affected by a 2-week exposure to 0.10 or 0.25 μl l_?1 SO₂. Both H₂S and SO₂ fumigation increased the content of sulfhydryl compounds and sulfate. A 2-week exposure to 0.25 μl l_?1 H₂S resulted in an increase in sulfhydryl and sulfate content of 250 to 450% and 63 to 248% in the shoots, respectively, depending on growth temperature. Exposure to 0.15 and 0.30 μl l_?1 H₂S at 20°C for 2 weeks resulted in a 46% increase in sulfate content of the shoots at 0.30 μl l_?1 and no detectable increase at 0.15 μl l_?1 H₂S; the sulfate content of the roots increased by 195 and 145% at 0.15 and 0.30 μl l_?1 H₂S, respectively. Fumigation with 0.25 μl l_?1 SO₂ at 20°C for 2 weeks resulted in an increase in sulfhydryl content and sulfate content in the shoots of 285% and 300 to 1100%. H₂S fumigation during the 12 h light period or only during the dark period resulted in identical growth reduction and accumulation of sulfhydryl compounds; they were about 50 and 67% of those observed in continuously exposed plants. H₂S- and SO₂-exposed plants showed an increased transpiration rate, which was mainly caused by an increased dark-period transpiration. No effect of H₂S and SO₂ on the water uptake of the plants and the osmotic potential of the leaves was detected. Plants fumigated with 0.25 μl l_?1 H₂S for 2 weeks were smaller and differed morphologically from the control plants by slightly more abaxially curved leaf margins. Cross sections of the leaves showed smaller cells at the margins and smaller and fewer air spaces. The increased transpiration in the H₂S-exposed plants is discussed in relation to the observed morphological changes.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Membrane glycoproteins involved in neurite fasciculation

Lectin affinity chromatography combined with mAb production was used to identify chick neural cell surface molecules related to L1 antigen, a mouse neural glycoprotein implicated in cell-cell adhesion (Rathjen, F. G., and M. Schachner, 1984, EMBO (Eur. Mol. Biol. Organ.) J., 3:1-10). A glycoprotein, G4 antigen, isolated by mAb G4 from adult chick brain is described which comprises a major 135-kD component, a minor doublet at 190 kD, and diffusely migrating bands at 80 and 65 kD in SDS PAGE. This molecule is structurally related to mouse L1 antigen according to NH2-terminal amino acid sequence (50% identity) as well as the behavior of its components in two-dimensional IEF/SDS PAGE gels. A second chicken glycoprotein, F11 antigen, was isolated from adult chick brain using mAb F11. This protein has also a major 135-kD component and minor components at 170 kD and 120 kD. Both immunotransfer analysis with polyclonal antibodies to mAb G4 and to mAb F11 isolate and the behavior on IEF/SDS PAGE gels indicates that the major 135-kD component of F11 antigen is distinct from G4 antigen components. However, the 135-kD component of F11 antigen shares with G4 antigen and the neural cell adhesion molecule (NCAM) the HNK-1/L2 carbohydrate epitope. In immunofluorescence studies, G4 and F11 antigenic sites were found to be associated mainly with the surface of process-bearing cells, particularly in fiber-rich regions of embryonic brain. Although Fab fragments of polyclonal antibodies to mAbs G4 or F11 immunoaffinity isolate only weakly inhibit the Ca2+-independent aggregation of neural cells, they strongly inhibit fasciculation of retinal axons. Together these studies extend the evidence that bundling of axons reflects the combined effects of a group of distinct cell surface glycoproteins.     

Cartilage electromechanics--II. A continuum model of cartilage electrokinetics and correlation with experiments

We have formulated a continuum model for linear electrokinetic transduction in cartilage. Expressions are derived for the streaming potential and streaming current induced by oscillatory, uniaxial confined compression of the tissue, as well as the mechanical stress generated by a current density or potential difference applied to the tissue. The experimentally observed streaming potential and current-generated stress response, measured on the same specimens, are compared with the predictions of the theory over a wide frequency range. The theory compares well with the data for reasonable values of cartilage intrinsic mechanical parameters and electrokinetic coupling coefficients. Experiments also show a linear relationship between the stimulus amplitude and the transduction response amplitude, within the range of stimulus amplitudes of interest. This observation is shown to be consistent with the predictions of the linear theory.