Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Effect of dietary boron on mineral, estrogen, and testosterone metabolism in postmenopausal women

A study was done to examine the effects of aluminum, magnesium, and boron on major mineral metabolism in postmenopausal women. This communication describes some of the effects of dietary boron on 12 women between the ages of 48 and 82 housed in a metabolic unit. A boron supplement of 3 mg/day markedly affected several indices of mineral metabolism of seven women consuming a low-magnesium diet and five women consuming a diet adequate in magnesium; the women had consumed a conventional diet supplying about 0.25 mg boron/day for 119 days. Boron supplementation markedly reduced the urinary excretion of calcium and magnesium; the depression seemed more marked when dietary magnesium was low. Boron supplementation depressed the urinary excretion of phosphorus by the low-magnesium, but not by the adequate-magnesium, women. Boron supplementation markedly elevated the serum concentrations of 17 beta-estradiol and testosterone; the elevation seemed more marked when dietary magnesium was low. Neither high dietary aluminum (1000 mg/day) nor an interaction between boron and aluminum affected the variables presented. The findings suggest that supplementation of a low-boron diet with an amount of boron commonly found in diets high in fruits and vegetables induces changes in postmenopausal women consistent with the prevention of calcium loss and bone demineralization.     

Simultaneous demonstration of two antigens in ultrathin cryosections by a novel application of an immunogold staining method using primary antibodies from the same species

A recently developed immunocytochemical double-staining method for ultrathin Epon and Lowicryl K4M sections has been adopted for use on ultrathin cryosections. The essential features of the method include: staining for the first antigen by the indirect method using sufficient concentrations of second antibodies conjugated to colloidal gold particles to saturate available epitopes on the primary antibodies; supporting the cryosections by methyl cellulose followed by paraformaldehyde vapour treatment (30-60 min at 80 degrees C); removal of the methyl cellulose followed by staining for the second antigen using primary antiserum from the same species and another size class of colloidal gold particles conjugated to second antibodies. Contaminating staining does not occur if the paraformaldehyde vapour treatment exceeds 30 min, as this treatment destroys the combining sites on the second antibodies applied in the first staining cycle. Successful double-staining was documented using primary rabbit antibodies to growth hormone and corticotropin and anti-rabbit IgG conjugated to 5 and 15 nm colloidal gold particles. Following double-staining, the ultrathin cryosections may be silver-enhanced to improve detectability of the markers at low magnification.     

Connective tissue influences on the expression of epithelial cell-surface antigens

Summary Adult mice were found to show regional variation in the epithelial expression of some molecules of the blood-group antigen series. To investigate connective tissue influences on such differences, heterotypic recombinants of epithelia and connective tissues from various regions were prepared and examined using monoclonal antibodies directed against bloodgroup antigens H and Le^y. The results indicate that epithelia may maintain a preexisting regionally specific pattern following recombination but that, in some recombinant matches, the connective tissue is capable of signalling redirection of the pattern of expression towards that typical of the epithelium with which it is normally associated.This work was supported by NIH-NIDR RO1-DEO-5190     

Temporal relation of antigenaemia and loss of antibodies to core antigens to development of clinical disease in HIV infection.

A total of 276 sequential serum samples from 34 men with antibodies to the human immunodeficiency virus (HIV) followed up for two to seven years were analysed for HIV antigen and antibodies to the viral core and envelope proteins. Results were correlated with clinical outcome and CD4 T lymphocyte count. Both antigenaemia and the disappearance of antibodies to the core protein were associated with development of the acquired immune deficiency syndrome (AIDS) or AIDS related complex and depletion of CD4 cells. Thus AIDS or AIDS related complex developed in eight out of 16 patients with antigenaemia compared with one out of 18 patients without antigenaemia. Low counts of CD4 cells (less than 0.5 X 10(9)/l) were found in 14 of the 16 patients with antigenaemia and five of the 18 without antigenaemia. Nine patients seroconverted to HIV during the study; two of these developed antigenaemia 14 and 16 months after the estimated time of seroconversion. These results show that the late stages of HIV infection are characterised by increased production of antigen and a decrease in antibodies directed against the core protein. Antigenaemia indicates a poor prognosis; and as the antigen test is simple to do and interpret, it may therefore be useful for selecting patients for antiviral treatment.     

Effects of phorbol esters on endothelial cell microfilaments: Laser scanning confocal microscopy and quantitative morphometry of dose dependent changes

Phorbol esters are known to alter microfilaments but it is not clear if the changes correspond to modulation of the phosphoinositide turnover/protein kinase C system. The novel technique of laser scanning confocal epifluorescence was used to study fiber orientation in phorbol ester treated cells. We treated endothelial cells with control agents and agents known to stimulate protein kinase C: 4 alpha-phorbol, phorbol 12-myristate 13-acetate (PMA), phorbol dibutyrate (PDB), or lipopolysaccharide. After incubation with the test agents, the endothelial cell microfilaments were stained with rhodamine pholloidin and viewed by conventional epifluorescence and by laser scanning confocal epifluorescence microscopy. The images obtained by the confocal microscopy corresponded to a thin optical section through the cells, 300 nm or more in thickness. The microfilaments extended predominantly in the plane of focus. After exposure of the cells to phorbol esters, the stress fibers became more nearly parallel in arrangement or were shortened, but remained in the plane of focus. The modification of microfilaments in response to phorbol esters was quantitated by a single blind analysis. In order to compare the morphological changes with a biochemical action of the phorbol esters, we measured phosphoinositide turnover. The dose-dependence of morphological changes was compared and contrasted to the dose-dependent effect of phorbol esters on bradykinin-stimulated phosphoinositide turnover. PMA had about the same EC50 (1-5 nM) for both biochemical and morphological processes. PDB was less potent in inducing the disruption of microfilament structure than in inhibiting phosphoinositide turnover. Lipopolysaccharide was ineffective in inducing a morphological change under these conditions. A simple activation of protein kinase C is insufficient to explain the dose-dependent effects of phorbol esters. Thus a morphometric analysis can help distinguish the potency of cytoskeleton modulators.     

Microbial introductions to apple leaves: Influences of altered immigration on fungal community dynamics

Fungal immigration to apple leaves in the field was altered by the introduction of populations ofChaetomium globosum orAureobasidium pullulans to surface-disinfested leaves either immediately following, or 6 days after, disinfestation. Total numbers of fungal individuals and numbers of filamentous fungal and yeast individuals were estimated and compared over time for 4–7 weeks on control leaves (leaves disinfested but no populations applied), onAureobasidium-treated, and onChaetomium-treated leaves. Fungal communities developing on leaves during three experiments in two different time frames (experiment 1: July 9–August 27; experiments 2 and 3: July 29–August 27), and thus under different immigration regimes, were also compared. Survival of introduced populations was not related to the presence of prior fungal immigrants. Rates of increase in total numbers of fungi and numbers of filamentous fungi and yeasts per leaf varied among experiments, apparently in relation to differences in immigration and environmental history. Differences among leaves in immigration had a short-term (days) influence on community size. However, no long-term effects of altered immigration on phylloplane fungal community size were evident.