Cellulose acetate electrophoresis of protein kinases: Detection of the active forms using various substrates

Electrophoresis on cellulose acetate strips was used to analyze protein kinases from normal rat liver. In addition to already well-characterized cAMP-dependent protein kinases type I and II and cAMP-independent casein kinases I and II, this method enabled the detection of several supplementary bands corresponding to kinases which were investigated according to their substrate specificity, activation by cAMP, and inhibition by the specific inhibitor of the catalytic subunit of cAMP-dependent protein kinases or by heparin. Using this rapid, sensitive, and resolutive electrophoretic method, different isozyme patterns could be obtained starting from minute amounts of different types of biological material.     

The importance of FeEDTA for reversibility of phosphate-induced chlorosis in maize (Zea mays L.)

Chlorosis induced with a supraoptimum dose of phosphorus in nutrient solution (69 mg P l^-1) was reverted by spraying of leaves of chlorotio maize plants (Zea mays L.) with FeEDTA. Biomass formation, chlorophyll and iron content were decreased in the above-ground parts of plants grown under chlorosis-inducing conditions. Spraying always decreased content of inorganic phosphorus (P_i/Fe ratio was significantly changed), increased chlorophyll content in old plants and stimulated dry mass formation at supraoptimum phosphorus doses. FeEDTA application improved phosphate utilization (portion of phosphate in organic bonds was increased). This may be the basis of chlorosis-reverting effect of FeEDTA.     

Stoicheiometry of dicyclohexylcarbodiimide-ATPase interaction in mitochondria

1. The oligomeric dicyclohexylcarbodiimide (DCCD)-binding protein of mitochondrial ATPase was studied using (a) the relationship between [¹⁴C]DCCD binding and inhibition of ATPase activities and (b) the analysis of the kinetics of inhibition. 2. The [¹⁴C]DCCD binding to bovine heart mitochondria is linearly proportional to the inhibition of ATP hydrolysis up to a 50% decrease of the original activity resulting in 0.6 mol DCCD bound covalently to the specific inhibitory site (Hous?t?k, J., Svoboda, P., Kopecký, J., Kuz?ela, S?. and Drahota, Z. (1981) Biochim. Biophys. Acta 634, 331–339) per mol of the fully inhibited enzyme. 3. Kinetics of the inhibition of both the ATPase activity (heart and liver mitochondria) and ADP-stimulated respiration (liver) reveal that 1 mol DCCD per mol ATPase eliminates both the synthetic and the hydrolytic activities. It is inferred that the activity-binding correlation underestimates the number of DCCD-reactive sites. 4. The second-order rate constant of the DCCD-ATPase interaction (k) is inversely related to the concentration of membranes, indicating that DCCD reaches the inhibitory site by concentrating in the hydrophobic (phospholipid) environment. 5. At a given concentration of liver mitochondria, comparable k values are obtained both for the inhibition of ATP hydrolysis (k=5.35·10²M^?1·min^?1) and ADP-stimulated respiration (k=5.67·10²M^?1·min^?1). 6. It is concluded that both the synthetic and the hydrolytic functions of ATPase are inhibited via a common single DCCD-reactive site. This site is represented by one of the several polypeptide chains forming the oligomer of the DCCD-binding protein. The inhibitor-ATPase interaction does not exhibit cooperativity, indicating that the preferential reactivity towards DCCD is an inherent property of the inhibitory site.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Dictyostelium myosin II heavy-chain kinase A is activated by heparin, DNA and acidic phospholipids and inhibited by polylysine, polyarginine and histones.

Dictyostelium myosin II heavy-chain kinase A (MHCK A) is activated by autophosphorylation. Heparin and DNA, as well as vesicles composed of phosphatidylserine or phosphatidylinositol, were found to increase the initial rate of MHCK A autophosphorylation 5-10-fold in a Ca(2+)-independent manner. The negatively charged molecules also increased the activity of the autophosphorylated MHCK A by about 2-fold. In contrast, positively charged polypeptides such as poly(D-lysine), poly(L-lysine), poly(L-arginine) and histones strongly inhibited (IC50 of 0.5 micrograms/ml) the activity of the active, autophosphorylated MHCK A. Similar levels of inhibition, on a weight basis, were observed for poly(L-lysine) fractions with molecular weights from 3800 to 150,000-300,000. The inhibition was competitive with respect to peptide substrate and mixed with respect to ATP. At much higher concentrations poly(L-lysine) also inhibited the ability of MHCK A to autophosphorylate. It is proposed that negatively charged compounds and autophosphorylation increase the activity of MHCK A by weakening the interaction between the catalytic domain and a positively charged autoinhibitory domain.     

Twinning and mitotic crossing-over: some possibilities and their implications

Mitotic crossing-over does occur in man and is much more frequent and important than generally assumed. Its postzygotic occurrence before an embryo differentiates into MZ twins is theoretically predicted to have disrupting effects on genomic imprinting and cis-acting sequences, with consequences ranging from early lethality to MZ twin discordance. Some predictions are at odds with classical views on twinning and include a high discordance rate of MZ twins for some genetic diseases. A review of MZ twin discordance and an attempt at explaining some of the data lead one to hypothesize both the existence of a sex differences in the rate of mitotic crossing-over and the impossibility for crossed X chromosomes to undergo inactivation. The close interrelationship of twinning and midline malformations further suggests a major role of mitotic crossing-over in the induction of the twinning process itself. The model can be tested with molecular methods and provides a new approach for the gene mapping of so-called multifactorial diseases and of rarer disorders with apparently irregular inheritance.     

Distribution of deletions and seven point mutations on CYP21B genes in three clinical forms of steroid 21-hydroxylase deficiency

To characterize mutations in the CYP21B gene that are responsible for congenital adrenal hyperplasia (CAH), DNA samples from 91 French patients have been studied by allelic-specific oligonucleotide hybridization and Southern blot analysis. Seven sites mostly found in the CYP21A pseudogene and deletions of the functional CYP21B gene have been screened. Gene conversions involving small DNA segments accounted for 57% of the tested mutations and probably cause 74% of the mutations responsible for the disease. Complete deletion of the CYP21B gene accounted for 18% of the CAH mutations in the whole sample and for 21% in the classical form of the disease. Three mutations were found associated with specific clinical forms of the disease: a G-C substitution in the seventh exon was associated with the late-onset form of the disease, and both an 8-bp depletion in the third exon and complete deletion of CYP21B were associated with the salt-wasting form.     

Interaction with functional membrane proteins--a common mechanism of toxicity for lipophilic environmental chemicals?

1. The effects of several phenols, anilines and aliphatic alcohols on yeast plasma membrane H(+)-ATPase and purine transport system as well as on Na+, K(+)-ATPase and adenosine uptake by Chinese hamster ovary cells (CHO) were investigated. 2. In all cases an inhibition was observed, which could be correlated with the octanol/water partition coefficients of the substances tested, thus making quantitative structure-activity predictions possible. 3. The observed effects correlated well with the influence of the chemicals on cell growth. 4. The results suggest a common mechanism of toxicity by the action of hydrophobic xenobiotics on biomembranes.