Cloning and functional characterization of the fatty acid elongase 1 (FAE1) gene from high erucic Crambe abyssinica cv. Prophet

A genomic fatty acid elongation 1 ( FAE1 ) clone was isolated from Crambe abyssinica . The genomic clone corresponds to a 1521-bp open reading frame, which encodes a protein of 507 amino acids. In yeast cells expression of CrFAE led to production of new very long chain monounsaturated fatty acids such as eicosenoic (20 : 1^Δ11) and erucic (22 : 1^Δ13) acids. Seed-specific expression in Arabidopsis thaliana resulted in up to a 12-fold increase in the proportion of erucic acid. On the other hand, in transgenic high-erucic Brassica carinata plants, the proportion of erucic acid was as high as 51.9% in the best transgenic line, a net increase of 40% compared to wild type. These results indicate that the CrFAE gene encodes a condensing enzyme involved in the biosynthesis of very long-chain fatty acids utilizing monounsaturated and saturated acyl substrates, with a strong capability for improving the erucic acid content.     

Angelman syndrome and hypothyroidism - coincidence or unique correlation?

Angelman Syndrome (AS, MIM 105830), classified among neurogenetic disorders, occurs with estimated frequency of 1:10 000 to 1:40 000. The characteristics features apart from neurodevelopmental impairment and seizures include peculiar face traits, absent speech, outburst of laughter, ataxia, stereotyped jerky (puppet-like) movements. The authors report three children with Angelman syndrome who were also diagnosed with hypothyroidism.     

Analysis of interaction between dendriplexes and bovine serum albumin

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.     

Genome survey sequencing of the wine spoilage yeast Dekkera (Brettanomyces) bruxellensis

The hemiascomycete yeast Dekkera bruxellensis, also known as Brettanomyces bruxellensis, is a major cause of wine spoilage worldwide. Wines infected with D. bruxellensis develop distinctive, unpleasant aromas due to volatile phenols produced by this species, which is highly ethanol tolerant and facultatively anaerobic. Despite its importance, however, D. bruxellensis has been poorly genetically characterized until now. We performed genome survey sequencing of a wine strain of D. bruxellensis to obtain 0.4x coverage of the genome. We identified approximately 3,000 genes, whose products averaged 49% amino acid identity to their Saccharomyces cerevisiae orthologs, with similar intron contents. Maximum likelihood phylogenetic analyses suggest that the relationship between D. bruxellensis, S. cerevisiae, and Candida albicans is close to a trichotomy. The estimated rate of chromosomal rearrangement in D. bruxellensis is slower than that calculated for C. albicans, while its rate of amino acid evolution is somewhat higher. The proteome of D. bruxellensis is enriched for transporters and genes involved in nitrogen and lipid metabolism, among other functions, which may reflect adaptations to its low-nutrient, high-ethanol niche. We also identified an adenyl deaminase gene that has high similarity to a gene in bacteria of the Burkholderia cepacia species complex and appears to be the result of horizontal gene transfer. These data provide a resource for further analyses of the population genetics and evolution of D. bruxellensis and of the genetic bases of its physiological capabilities.     

Localization of ligand binding site in proteins identified in silico

Knowledge-based models for protein folding assume that the early-stage structural form of a polypeptide is determined by the backbone conformation, followed by hydrophobic collapse. Side chain–side chain interactions, mostly of hydrophobic character, lead to the formation of the hydrophobic core, which seems to stabilize the structure of the protein in its natural environment. The fuzzy-oil-drop model is employed to represent the idealized hydrophobicity distribution in the protein molecule. Comparing it with the one empirically observed in the protein molecule reveals that they are not in agreement. It is shown in this study that the irregularity of hydrophobic distributions is aim-oriented. The character and strength of these irregularities in the organization of the hydrophobic core point to the specificity of a particular protein’s structure/function. When the location of these irregularities is determined versus the idealized fuzzy-oil-drop, function-related areas in the protein molecule can be identified. The presented model can also be used to identify ways in which protein–protein complexes can possibly be created. Active sites can be predicted for any protein structure according to the presented model with the free prediction server at . The implication based on the model presented in this work suggests the necessity of active presence of ligand during the protein folding process simulation. Figure Fuzzy-oil-drop model applied to identify the ligation site in lysozyme complexed with N-acetylglucosamine (PDB ID:1LMQ) in form of hydrophobicity deficiency (ΔH) profile and three-dimensional distribution of on protein surface     

Ionic liquids for the production of insecticidal and microbicidal extracts of the fungus Cantharellus cibarius

Different ionic liquids were used as solvents for the effective extraction of the active metabolites of the fruit bodies of C. cibarius. The type of ionic liquid was found to play a significant role in this process. We found that the protic ionic liquid 1-[(nonyloxy)methyl]-1H-imidazol-3-ium salicylate (6) is a most-efficient extracting agent, being superior to classical solvents such as AcOEt or hexane. The obtained extracts generally revealed high insecticidal activities against both house fly and cockroach, with similar potencies as the standard pesticides bromfenvinphos or alphacypermethrin, as well as significant activities against bacteria, yeast, and moulds. Notably, the cidal activities against plant-pathogenic bacteria were stronger than against human bacterial strains.     

The structure of a full-length response regulator from Mycobacterium tuberculosis in a stabilized three-dimensional domain-swapped, activated state

The full-length, two-domain response regulator RegX3 from Mycobacterium tuberculosis is a dimer stabilized by three-dimensional domain swapping. Dimerization is known to occur in the OmpR/PhoB subfamily of response regulators upon activation but has previously only been structurally characterized for isolated receiver domains. The RegX3 dimer has a bipartite intermolecular interface, which buries 2357 A(2) per monomer. The two parts of the interface are between the two receiver domains (dimerization interface) and between a composite receiver domain and the effector domain of the second molecule (interdomain interface). The structure provides support for the importance of threonine and tyrosine residues in the signal transduction mechanism. These residues occur in an active-like conformation stabilized by lanthanum ions. In solution, RegX3 exists as both a monomer and a dimer in a concentration-dependent equilibrium. The dimer in solution differs from the active form observed in the crystal, resembling instead the model of the inactive full-length response regulator PhoB.     

A Conserved Secondary Structural Element in the Coding Region of the Influenza A Virus Nucleoprotein (NP) mRNA Is Important for the Regulation of Viral Proliferation

Influenza A virus is a threat to humans due to seasonal epidemics and infrequent, but dangerous, pandemics that lead to widespread infection and death. Eight segments of RNA constitute the genome of this virus and they encode greater than eight proteins via alternative splicing of coding (+)RNAs generated from the genomic (-)RNA template strand. RNA is essential in its life cycle. A bioinformatics analysis of segment 5, which encodes nucleoprotein, revealed a conserved structural motif in the (+)RNA. The secondary structure proposed by energy minimization and comparative analysis agrees with structure predicted based on experimental data using a 121 nucleotide in vitro RNA construct comprising an influenza A virus consensus sequence and also an entire segment 5 (+)RNA (strain A/VietNam/1203/2004 (H5N1)). The conserved motif consists of three hairpins with one being especially thermodynamically stable. The biological importance of this conserved secondary structure is supported in experiments using antisense oligonucleotides in cell line, which found that disruption of this motif led to inhibition of viral fitness. These results suggest that this conserved motif in the segment 5 (+)RNA might be a candidate for oligonucleotide-based antiviral therapy.