The cysteine-rich and C-terminal domains of dystrophin are not required for normal costameric localization in the mouse

Dystrophin has a modular structure and is believed to be critical for muscle cell cytoarchitecture by linking the cytoskeleton to the extracellular matrix. The N-terminus binds to actin and two domains at the C-terminus, the cysteine-rich and C-terminal domains, are associated with the sarcolemma indirectly via the dystroglycan complex. We have generated a mutation in mouse embryonic stem (ES) cells which serves to delete the cysteine-rich and C-terminal domains to address directly their role. We show that these two domains are not necessary for normal costameric organization at the sarcolemma in myotubes derived from the mutant cell line. Furthermore sarcolemmal localization is also apparent in mouse chimaeric musclein vivo.     

Comparison of human and chimpanzee ξ1 blobin genes

Summary The DNA base sequences of the entire chimpanzee 1 globin gene and an additional 1 kb of DNA flanking both the human and chimpanzee genes have been determined. Whereas the human 1 gene contains a termination codon in the sixth position, the chimpanzee gene appears to be functional. This finding confirms Proudfoot et al.'s suggestion that the human 1 gene was recently inactivated. Like the corresponding human 1 and 2 genes, the first and second introns of the chimpanzee 1 gene are occupied largely by tandem repeats of short oligonucleotides. These tandem repeats have undergone several rearrangements since the divergence of the human and chimpanzee 1 genes.     

Posterior Parietal Cortex Drives Inferotemporal Activations During Three-Dimensional Object Vision

The primate visual system consists of a ventral stream, specialized for object recognition, and a dorsal visual stream, which is crucial for spatial vision and actions. However, little is known about the interactions and information flow between these two streams. We investigated these interactions within the network processing three-dimensional (3D) object information, comprising both the dorsal and ventral stream. Reversible inactivation of the macaque caudal intraparietal area (CIP) during functional magnetic resonance imaging (fMRI) reduced fMRI activations in posterior parietal cortex in the dorsal stream and, surprisingly, also in the inferotemporal cortex (ITC) in the ventral visual stream. Moreover, CIP inactivation caused a perceptual deficit in a depth-structure categorization task. CIP-microstimulation during fMRI further suggests that CIP projects via posterior parietal areas to the ITC in the ventral stream. To our knowledge, these results provide the first causal evidence for the flow of visual 3D information from the dorsal stream to the ventral stream, and identify CIP as a key area for depth-structure processing. Thus, combining reversible inactivation and electrical microstimulation during fMRI provides a detailed view of the functional interactions between the two visual processing streams.     

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.     

A smiple specific assay for uracil tRNA methylases of enteric bacteria: use of ribothymidine-deficient tRNA

A simple quantitative assay that is about 95% specific for uracil tRNA methylases of E. coli and A. aerogenes has been developed. tRNA was isolated from a strain of E. coli carrying the trm^? mutation. These organisms have a low level of uracil methylase and consequently produce tRNA with a selective deficiency of ribothymidine. This RNA acted as a specific substrate for uracil tRNA methylases, when exposed to cell extracts from E. coli or A. aerogenes containing tRNA-methylating enzymes of multiple specificities. This assay can be used to screen organisms for trm^? mutations and for studies with inhibitors.     

Efficacy of Beauveria bassiana applications on coffee berry borer across an elevation gradient in Hawaii

ABSTRACT

The effect of three rates of a commercial formulation of Beauveria bassiana Strain GHA was evaluated against the coffee berry borer (CBB) Hypothenemus hampei Ferrari (Coleoptera: Curculionidae: Scolytinae), at three commercial coffee farms located at different altitudes on the island of Hawaii. H. hampei infestation and natural prevalence of B. bassiana increased with the elevation. At 145 metres above sea level (Farm 1), beetle infestation was 3.9%; at 538?m (Farm 2), beetle infestation was 12.2%; and at 768?m (Farm 3) infestation was 22.3%. The prevalence of natural B. bassiana killing CBB was 5.5% on Farm 1, 3.3% on Farm 2 and 23.1% on Farm 3. Monthly applications of B. bassiana resulted in no significant differences in levels of CBB infestation among treatments. Similarly, rates of infested berries with visually detectable signs of B. bassiana were similar among the B. bassiana treatments, ranging from 0.44% to 4.24%, and those percentages were larger than the treatments without B. bassiana. The percentage of females killed by Beauveria ranged from 69% to 95%. Effect of dose of BotaniGard^® ES was reduced when beetles were in C position compared to A and B positions. B. bassiana can be an important component of an integrated pest management program for CBB.     

Some insectary experiments with predacious mites to determine their effect on the development of Metatetranychus ulmi (Koch) populations

Summary As field spraying experiments give results which are difficult to resolve in terms of individual predator species, a series of experiments has been carried out in an insectary to find out what effect predacious mites of various species have upon populations of Metatetranychus ulmi (Koch), in the absence of other prey. Known numbers of each mite species were placed on seedling plants, and the development of the resulting populations followed.In one experiment, where initial numbers of 5, 25 or 50 M. ulmi females were placed on a plant, together with five females of Typblodromus tiliae Oudms., the M. ulmi population in every case remained throughout the following three months at a density of less than one mite per leaf, which was less than a total of 50 mites per plant. Where the same numbers of M. ulmi started in the absence of T. tiliae, a rapid increase of M. ulmi resulted in populations of over 3000 mites per plant in up to eleven weeks.It was also found that both the size of the host plant, and the initial ratio of M. ulmi and T. tiliae, had an effect on the development of the T. tiliae populations.Of other predacious species, T. finlandicus was similar to T. tiliae in its effect on M. ulmi. Although T. umbraticus itself increased steadily, it exerted little effect on the M. ulmi population, nor did T. tiliarum which, however, did not develop well under these conditions. Phytoseius macropilis (Banks) was also slow to increase and had little effect on the M. ulmi population.

---

Zusammenfassung Man hat aus Freilandversuchen gefolgert, daß gewisse Typhlodromus-Arten eine wichtige Rolle bei der Bekämpfung von Metatetranychus ulmi (Koch) spielen können, obwohl die Beurteilung der. Ergebnisse nach der Anwendung von Chemikalien und in Gegenwart räuberischer Insekten oft erschwert ist. Um diese Komplikationen auszuschalten, wurden Versuche in einem Insektarium durchgeführt, wo die Wirkung von Typhlodromus auf M. ulmi in Abwesenheit anderer Beute geschätzt werden kann.Wenn Ausgangszahlen von 5, 25 oder 50 M. ulmi-Weibchen zusammen mit 5 Weibchen von Typhlodromus tiliae Oudms. an kleine Pflanzen gesetzt wurden, blieb die M. ulmi Population während der folgenden drei Monate in jedem Fall niedrig und überstieg die durchschnittliche Dichte von einer Milbe pro Blatt oder eine Summe von 50 Milben pro Pflanze nicht. Wenn die gleichen Anzahlen von M. ulmi-Weibchen in Abwesenheit von T. tiliae angesetzt wurden, so ergab sich ein jäher Anstieg zu Populationen von über 3000 Milben je Pflanze im Zeitraum bis zu 11 Wochen und bald folgte Bronzefärbung der Blätter.Die Größe der Wirtspflanzen beeinflußte die Entwicklung der T. tiliae-Populationen ebenso wie das Ausgangsverhältnis von M. ulmi zu T. tiliae. Sowohl größere Wirtspflanzen wie höhere M. ulmi-Werte führen zu größeren T. tiliae-Zahlen.Von anderen räuberischen Arten hat Typhlodromus finlandicus (Oudms.) eine ähnliche Wirkung auf M. ulmi wie T. tiliae. Obwohl Typhlodromus umbraticus Chant sich selbst stetig vermehrte, übte er einen geringen Einfluß auf die M. ulmi-Populationen aus; ebenso wenig Typhlodromus tiliarum Oudms., welcher sich jedoch unter der gegebene Bedingungen nicht gut entwickelte. Auch Phytoseius macropilis (Banks) zeigte nur langsames Wachstum und hatte wenig Wirkung auf die M. ulmi-Population.So wurde nachgewiesen, daß T. tiliae unter etwas begrenzten Bedingungen und in Abwesenheit irgendeiner anderen Beute fähig ist, Populationen von M. ulmi auf einer relativ niedrigen und gleichbleibenden Dichte zu halten, woraus sich eine Stütze für die Theorie ergibt, daß das auch unter Obstgartenverhältnissen zutrifft.

     

The influence of spatial scale on the genetic structure of a widespread tropical wetland tree, Pterocarpus officinalis (Fabaceae)

Identifying factors that cause genetic differentiation in plant populations and the spatial scale at which genetic structuring can be detected will help to understand plant population dynamics and identify conservation units. In this study, we determined the genetic structure and diversity of Pterocarpus officinalis, a widespread tropical wetland tree, at three spatial scales: (1) drainage basin “watershed” (<10 km), (2) within Puerto Rico (<100 km), and (3) Caribbean-wide (>1000 km) using AFLP. At all three spatial scales, most of the genetic variation occurred within populations, but as the spatial scale increased from the watershed to the Caribbean region, there was an increase in the among population variation (Φ_ST=0.19 to Φ_ST=0.53). At the watershed scale, there was no significant differentiation (P=0.77) among populations in the different watersheds, although there was some evidence that montane and coastal populations differed (P<0.01). At the island scale, there was significant differentiation (P<0.001) among four populations in Puerto Rico. At the regional scale (>1000 km), we found significant differentiation (P<0.001) between island and continental populations in the Caribbean region, which we attributed to factors associated with the colonization history of P. officinalis in the Neotropics. Given that genetic structure can occur from local to regional spatial scales, it is critical that conservation recommendations be based on genetic information collected at the appropriate spatial scale.