Comparison of human and chimpanzee ξ1 blobin genes

Summary The DNA base sequences of the entire chimpanzee 1 globin gene and an additional 1 kb of DNA flanking both the human and chimpanzee genes have been determined. Whereas the human 1 gene contains a termination codon in the sixth position, the chimpanzee gene appears to be functional. This finding confirms Proudfoot et al.'s suggestion that the human 1 gene was recently inactivated. Like the corresponding human 1 and 2 genes, the first and second introns of the chimpanzee 1 gene are occupied largely by tandem repeats of short oligonucleotides. These tandem repeats have undergone several rearrangements since the divergence of the human and chimpanzee 1 genes.     

Calcium amelioration of cadmium-induced cytotoxicity in cultured rat hepatocytes

Summary Parenchymal hepatocytes from neonatal rats were isolated, cultured about 24 h, exposed to cadmium with or without calcium, and processed for scanning electron microscopy. To assess the severity of cadmium-induced changes, exposed hepatocytes were categorized based upon the extent of morphological damage. Differences in surface blebbing, alterations in microvilli, variations in the degree of swelling, and changes in cell shape were used to categorize the severity of cell damage. A double-blind morphometric analysis (a geometricostatistical processing of two-dimensional data for the collection of three-dimensional information) of cellular changes was conducted for each exposure time and for each concentration of cadmium in the presence or absence of calcium. Significant decreases occurred in the percent relative volume of normal, flattened cells present in cultures exposed for 30 min to 50 or 100 μM cadmium in the absence of calcium. In contrast, the percent relative volume of severely damaged spherical cells was significantly increased after exposure to solutions containing 50 or 100 μM cadmium and lacking calcium. Percent relative volume of intermediate cells (which were slightly swollen and showed changes in microvillar number) was significantly increased following a 30 min exposure to all cadmium concentrations in the absence of calcium. The examination of hepatocytes exposed for 60 min showed that the degree of cadmium-induced cytotoxicity was more severe in the absence of calcium than was the case for the hepatocyte cultures exposed for 30 min: approximately 30% more spherical cells and 30% fewer flattened cells were present if cultures were exposed in the absence of calcium for 60 min compared to those exposed for 30 min. The degree of blebbing was significantly greater at all cadmium concentrations in the absence of calcium. The presence of calcium, therefore, reduced cadmium-induced cytotoxicity in primary cultures of rat hepatocytes subjected to morphometric analysis after scanning electron microscopy.     

Variability in essential oil composition of Piper dilatatum L.C. Rich

Twelve samples of air-dried aerial parts of Piper dilatatum L. C. Rich yielded essential oils and their volatile constituents were analyzed by GC and GC–MS. Sesquiterpenes, both hydrocarbons and oxygenated, were the most highly represented classes, the former ranging from 31.5% to 87.7% and the latter varying from 1.8% to 49.4%. Using hierarchical cluster analysis, the oils were divided into seven groups, whose main constituents were: (E)-caryophyllene, α-cadinol and germacrene D (group A); spathulenol, bicyclogermacrene and (Z)-β-ocimene, (group B); spathulenol, germacrene D and (E)-nerolidol, (group C); germacrene D, limonene, α-phellandrene and bicyclogermacrene (group D); β-elemene, germacrene D and β-pinene (group E); curzerene, p-cymene and α-eudesmol (group F); and (Z)-α-bisabolene, curzerene and germacrene D (group G). We have seen that Piper oils from the Amazon present as major constituents terpenoids and phenylpropanoids, always with the predominance of one over another. The essential oils of P. dilatatum presented in this paper, containing only mono- and sesquiterpenes as its major components, is further chemotaxonomic evidence of this dichotomy in the Piper genus.     

Posterior Parietal Cortex Drives Inferotemporal Activations During Three-Dimensional Object Vision

The primate visual system consists of a ventral stream, specialized for object recognition, and a dorsal visual stream, which is crucial for spatial vision and actions. However, little is known about the interactions and information flow between these two streams. We investigated these interactions within the network processing three-dimensional (3D) object information, comprising both the dorsal and ventral stream. Reversible inactivation of the macaque caudal intraparietal area (CIP) during functional magnetic resonance imaging (fMRI) reduced fMRI activations in posterior parietal cortex in the dorsal stream and, surprisingly, also in the inferotemporal cortex (ITC) in the ventral visual stream. Moreover, CIP inactivation caused a perceptual deficit in a depth-structure categorization task. CIP-microstimulation during fMRI further suggests that CIP projects via posterior parietal areas to the ITC in the ventral stream. To our knowledge, these results provide the first causal evidence for the flow of visual 3D information from the dorsal stream to the ventral stream, and identify CIP as a key area for depth-structure processing. Thus, combining reversible inactivation and electrical microstimulation during fMRI provides a detailed view of the functional interactions between the two visual processing streams.     

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.     

Efficacy of Beauveria bassiana applications on coffee berry borer across an elevation gradient in Hawaii

ABSTRACT

The effect of three rates of a commercial formulation of Beauveria bassiana Strain GHA was evaluated against the coffee berry borer (CBB) Hypothenemus hampei Ferrari (Coleoptera: Curculionidae: Scolytinae), at three commercial coffee farms located at different altitudes on the island of Hawaii. H. hampei infestation and natural prevalence of B. bassiana increased with the elevation. At 145 metres above sea level (Farm 1), beetle infestation was 3.9%; at 538?m (Farm 2), beetle infestation was 12.2%; and at 768?m (Farm 3) infestation was 22.3%. The prevalence of natural B. bassiana killing CBB was 5.5% on Farm 1, 3.3% on Farm 2 and 23.1% on Farm 3. Monthly applications of B. bassiana resulted in no significant differences in levels of CBB infestation among treatments. Similarly, rates of infested berries with visually detectable signs of B. bassiana were similar among the B. bassiana treatments, ranging from 0.44% to 4.24%, and those percentages were larger than the treatments without B. bassiana. The percentage of females killed by Beauveria ranged from 69% to 95%. Effect of dose of BotaniGard^® ES was reduced when beetles were in C position compared to A and B positions. B. bassiana can be an important component of an integrated pest management program for CBB.     

Changes in Aldose Reductase After Crush Injury of Normal Rat Sciatic Nerve

The response of aldose reductase (AR) to crush injury was studied in normal rat sciatic nerve. Enzyme activity and immunoreactivity of AR were determined at intervals of 1, 5, 14, 28, and 35 days after crush and correlated with histologic and immunocytochemical observations. During nerve degeneration in the distal segments of crushed nerves, a significant reduction in AR activity was detected. At 5 and 14 days, coincident with Schwann cell proliferation, enzyme activity decreased by nearly two- and fourfold, respectively. Although activity of AR increased by 28 days during nerve regeneration, it was not restored to normal levels at 35 days. Similar reductions were observed with the immunoblotting of the enzyme. Quantitative analysis of immunogold labelling on electron micrographs confirmed that proliferating as well as remyelinating Schwann cells contained reduced gold particle density compared to Schwann cells of noncrushed myelinated fibers. Immunoblots of P0, a marker for the degree of Schwann cell differentiation or myelination, showed that the temporal sequence of changes in P0 paralleled that of AR. Thus expression of AR is a function of differentiated or mature Schwann cells. The putative volume regulatory role of AR in Schwann cells may become superfluous during Wallerian degeneration.     

SEED GERMINATION STUDIES IN MUSA. II. ALTERNATING TEMPERATURE REQUIREMENT FOR THE GERMINATION OF MUSA BALBISIANA

Stotzky , G., and Elsie A. Cox . (Central Research Labs., United Fruit Co., Norwood, Mass.) Seed germination studies in Musa. II. Alternating temperature requirement for the germination of Musa balbisiana. Amer. Jour. Bot. 49(7): 763–770. Illus. 1962.—Alternating temperatures were found to be required for the germination of seeds of Musa balbisiana. The temperature differentials optimal for germination in soil are dependent upon both the high and low temperatures, and range from 8–23 C. Germination is maximal when the seeds are held 6–12 hr at the high (27–35 C) and 12–18 hr at the low (12–18 C) temperatures. Some germination can be induced by short exposures to alternating temperatures followed by constant high temperatures, but continuous exposure to alternating temperatures is necessary for maximum germination. Excised embryos develop better at constant than at alternating temperatures, showing that the mechanisms affected by alternating temperatures reside elsewhere in the seed. Alternating temperatures are also required for germination of mechanically scarified seeds, although the temperature differentials are less than those necessary for intact seeds, indicating that the action of alternating temperatures is not on the permeability of the integuments.     

ATP augments von Willebrand factor-dependent shear-induced platelet aggregation through Ca2+-calmodulin and myosin light chain kinase activation

Shear stress triggers von Willebrand factor (VWF) binding to platelet glycoprotein Ibalpha and subsequent integrin alpha(IIb)beta(3)-dependent platelet aggregation. Concomitantly, nucleotides are released from plateletdense granules, and ADP is known to contribute to shear-induced platelet aggregation (SIPA). We found that the impaired SIPA of platelets from a Hermansky-Pudlak patient lacking dense granules was restored by exogenous l-beta,gamma-methylene ATP, a stable P2X(1) agonist, as well as by ADP, confirming that in addition to ADP (via P2Y(1) and P2Y(12)), ATP (via P2X(1)) also contributes to SIPA. Likewise, SIPA of apyrase-treated platelets was restored upon P2X(1) activation with l-beta,gamma-methylene ATP, which promoted granule centralization within platelets and stimulated P-selectin expression, which is a marker of alpha-granule release. In addition, during SIPA, platelet degranulation required both extracellular Ca(2+) and VWF-glycoprotein Ibalpha interactions without involving alpha(IIb)beta(3). Neither platelet release nor SIPA was affected by protein kinase C inactivation, even though protein kinase C blockade inhibits platelet responses to collagen and thrombin in stirring conditions. In contrast, inhibiting myosin light chain (MLC) kinase with ML-7 reduced platelet release and SIPA by 30%. Accordingly, the potentiating effect of P2X(1) stimulation on the aggregation of apyrase-treated platelets coincided with intensified phosphorylation of MLC and was abrogated by ML-7. SIPA-induced MLC phosphorylation occurred exclusively through released nucleotides and selective antagonism of P2X(1) with MRS2159-reduced SIPA, ATP release, and potently inhibited MLC phosphorylation. We conclude that the P2X(1) ion channel induces MLC-mediated cytoskeletal rearrangements, thus contributing to SIPA and degranulation during VWF-triggered platelet activation.