Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.     

Complotypes in individuals of African origin: frequencies and possible extended MHC haplotypes

We analyzed the frequency distribution of 106 complotypes [four allele sets of the major histocompatibility complex (MHC) genes for the complement proteins factor B, C2, C4A, and C4B] from 32 Black families residing in Boston and Washington, DC. Twenty-five different complotypes were identified, among which there were four complotypes that had not been previously observed in our large database of complotypes compiled from family studies of Boston Caucasians and that are, presumably, unique to individuals of African origin. These four African-derived complotypes areFC(1,90)0, FC63, S1C2,17, andSC(3,2,90)0. The frequencies of two of these four unique Black complotypes,FC(1,90)0 andFC63, were increased significantly when compared to Caucasians (p_corr <0.00042, p_corr=0.00294, respectively). The complotypeFC(1,90)0 was in positive linkage disequilibrium withHLA-DR3 haplotypes containing theB locus antigens Bw42, Bw52, Bw53, and Bw58, whileFC63 was associated withHLA-Bw70,-DR5. These findings demonstrate the extensive polymorphism of complotypes in Blacks, and also suggest that it may be possible to define unique extended haplotypes of African origin.     

Molecular genetic study of human arginase deficiency

We have explored the molecular pathology in 28 individuals homozygous or heterozygous for liver arginase deficiency (hyperargininemia) by a combination of Southern analysis, western blotting, DNA sequencing, and PCR. This cohort represents the majority of arginase-deficient individuals worldwide. Only 2 of 15 homozygous patients on whom red blood cells were available had antigenically cross-reacting material as ascertained by western blot analysis using anti-liver arginase antibody. Southern blots of patient genomic DNAs, cut with a variety of restriction enzymes and probed with a near-full-length (1,450-bp) human liver arginase cDNA clone, detected no gross gene deletions. Loss of a TaqI cleavage site was identified in three individuals: in a homozygous state in a Saudi Arabian patient at one site, at a different site in homozygosity in a German patient, and in heterozygosity in a patient from Australia. The changes in the latter two were localized to exon 8, through amplification of this region by PCR and electrophoretic analysis of the amplified fragment after treatment with TaqI; the precise base changes (Arg291X and Thr290Ser) were confirmed by sequencing. It is interesting that the latter nucleotide variant (Thr290Ser) was found to lie adjacent to the TaqI site rather than within it, though whether such a conservative amino acid substitution represents a true pathologic mutation remains to be determined. We conclude that arginase deficiency, though rare, is a heterogeneous disorder at the genotypic level, generally encompassing a variety of point mutations rather than substantial structural gene deletions.     

X-ray crystallographic analysis of inhibition of endothiapepsin by cyclohexyl renin inhibitors.

The crystal structures of endothiapepsin, a fungal aspartic proteinase (EC 3.4.23.6), cocrystallized with two oligopeptide renin inhibitors, PD125967 and PD125754, have been determined at 2.0-A resolution and refined to R-factors of 0.143 and 0.153, respectively. These inhibitors, which are of the hydroxyethylene and statine types, respectively, possess a cyclohexylalanine side chain at P1 and have interesting functionalities at the P3 position which, until now, have not been subjected to crystallographic analysis. PD125967 has a bis(1-naphthylmethyl)acetyl residue at P3, and PD125754 possesses a hydroxyethylene analogue of the P3-P2 peptide bond for proteolytic stability. The structures reveal that the S3 pocket accommodates one naphthyl ring with conformational changes of the Asp 77 and Asp 114 side chains, the other naphthyl group residing in the S4 region. The P3-P2 hydroxyethylene analogue of PD125754 forms a hydrogen bond with the NH of Thr 219, thereby making the same interaction with the enzyme as the equivalent peptide groups of all inhibitors studied so far. The absence of side chains at the P2 and P1' positions of this inhibitor allows water molecules to occupy the respective pockets in the complex. The relative potencies of PD125967 and PD125754 for endothiapepsin are consistent with the changes in solvent-accessible area which take place on inhibitor binding.     

Embodying illness,embodying cancer

Individuals and societies embody illnesses in different ways, in part determined by the way a person knows and lives his or her diagnosis and prognosis. Based on research in Northern Italy, on the experiences and meanings of cancer and on the practice of nondisclosure of the diagnosis, we find nondisclosure reflects a world divided - life/death, good/bad, mind/body — with the unwanted converted to other. The strong association of cancer with death, suffering, and hopelessness in much of Italy, coupled with the tremendous power attributed to naming and sentencing makes nondisclosure a major mechanism for keeping the condemned in this social world, and keeping death, decay, and suffering in the other. It is the social reality that is dominant here, such that informing a patient of cancer can be tantamount to social death.

---

Résumé Les individus et les sociétés incorporent la maladie de façon différente, déterminée en partie de comment une personne connait et vit son diagnostic et prognostic. A partir de la recherche des experiences des significations du cancer et de la pratique de ne pas dire la diagnostic au Nord de l'Italie, on a remarqué que l'habitude de ne rien dire reflète un monde séparé entre la vie et la mort, entre le bon et le mal, entre l'esprit et le corps, de sorte que ce qui West pas voulu soit transfomé en l'autre. L'association forte du cancer à la mort, à la souffrance, au désespérance en toute l'Italie, unie au grand pouvoir donne au fait de dénommer et de donner une sentence, rend ne pas dire un méchanisme important pour garder le condamnd dans ce monde social et pour garder la mort, la décadence et la souffrance dans l'autre. C'est la réalité sociale qui est ici dominante, tel que le fait d'informer un patient de cancer soit comme une mort sociale.

     

A new major histocompatibility complex class I b gene expressed in the mouse blastocyst and placenta

 Because of the role major histocompatibility complex (MHC) class I b molecules may play during mouse embryonic development, we thought it would be interesting to search for additional MHC class I b molecules that might be expressed in preimplantation embryos, and in particular in the trophoblastic lineage. We therefore screened a mouse preimplantation blastocyst cDNA library for MHC class I sequences. This search led to the identification and characterization of a new MHC class I b gene, blastocyst MHC. Sequences identical to the exons and 3′ untranslated region of this gene have been found in many laboratory mouse strains, as well as in the related mouse species Mus spreciligus. The presence of this gene in mouse strains of different MHC class I haplotypes argues that blastocyst MHC is a unique, newly-described gene rather than a new allele of a previously described mouse MHC class I gene. Blastocyst MHC has the structure of an MHC class I b gene, with the six exons characteristic of T-region genes. It is linked to H2-D. The amino acid sequence encoded by this gene maintains all the features of a functional antigen-presentation domain. The blastocyst MHC gene, like the human class I b gene HLA-G, is expressed at the blastocyst stage and in the placenta, and may be the mouse analog for HLA-G. Received: 31 May 1996 / Revised: 19 August 1996     

Identifying DNA polymorphisms in human TCRA/D variable genes by direct sequencing of PCR products

 The T-cell receptor (TCR) is a highly variable molecule composed of two polypeptide chains that recognize antigenic peptides in the context of major histocompatibility complex (MHC) molecules. In this study, we describe a sequence-based search for germline polymorphisms in the variable (V) gene segments of the human TCRA/D locus. Thirty different V gene segments were amplified from six to eight unrelated individuals and sequenced from low melting point agarose. Twenty-seven polymorphisms were identified in 15 V gene segments. These polymorphisms are mainly single nucleotide substitutions, but an insertion/deletion polymorphism and a single dinucleotide repeat with variable length were also seen. Of the 15 sequence variations found in the coding regions, six are silent and nine encode amino acid changes. All of the amino acid changes are found at non-conserved residues, frequently in the hypervariable regions, where they may influence MHC and/or peptide recognition. Therefore, it is possible that germline variations in TCR genes could influence an individual’s immune response, and may also contribute to susceptibility to diseases such as autoimmunity. Received: 9 January 1996 / Revised: 22 February 1996     

The MAN antigens are non-lamin constituents of the nuclear lamina in vertebrate cells

The characterization of the human antiserum designated MAN has led to the identification of a subset of non-lamin proteins that are exclusively located at the nuclear periphery in all vertebrate cell types examined, from human to fish. Immunoreactive protein species were whown to comprise three major polypeptides of M _r 78000, 58000 and 40000. These antigens co-partitioned with the nuclear lamina during in situ isolation of nuclear matrices from lamin A/C-positive and-negative mammlian cells. Using double immunofluorescence, the spatial relationship of MAN antigens to type-A and type-B lamins was further examined throughout the cell cycle of lamin A/C-positive mammalian cells. In interphase HeLa and 3t3 cells, MAN antigens colocalized with both types of lamins at the periphery of the nucleus, but were absent from intranuclear foci of lamin B. As HeLa cells proceeded into mitosis, MAN antigens were seen to segregate from lamins A/C and coredistribute with lamin B. Lamins A/C disassembled during late prophase/early prometaphase and reassociated with chromatin in telophase/cytokinesis. In contrast, MAN antigens and lamin B dispersed late during prometaphase and reassembled on chromosomes in anaphase. Altogether, our data suggest that MAN antigens may play key functions in the maintenance of the structural integrity of the nuclear compartment in vertebrate cells.