Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

A Computational Analysis on the Specificity of Interactions Between Histidine Kinases and Response Regulators

Abstract

Bacteria process and transmit signals simultaneously through several two-component/phos-phorelay networks using closely related proteins. Therefore discrimination against mismatches and discrete recognition between protein partners is an absolute requirement for producing the correct responses. We tried to address this issue by comparing and analyzing sequences from the helix-bundle regions of histidine kinases of Bacillus subtilis. Our analysis shows how conservation and variability in the sequences give rise to selective association and unique recognition. The observed pattern suggests that the chances for cross talk between non-partner proteins are extremely low, but cross talk could take place in special cases.     

Assessment of Soluble and Biomass K in Culture Medium Is a Reliable Tool for Estimation of K Releasing Efficiency of Bacteria

Abstract

Assessing the amount of released K from minerals in bacterial liquid culture is the main process for screening and isolation of efficient potassium releasing bacteria (KRB). This study was aimed to determine the amount of released K in solution phase or supernatant (SK) as well as microbial biomass K (MBK). Therefore, 20 different bacterial isolates belonging to the 10 bacterial genera (Beijerinckia, Klebsiella, Azotobacter, Pseudomonas, Agrobacterium, Rhizobium, Sphingomonas, Citrobacter, Microbacterium, and Achromobacter) were individually used to inoculate Aleksandrov medium in presence of biotite or muscovite. Our results from in-vitro experiments revealed that the MBK (K in pellet) is more important than in SK. Although some genera such as Azotobacter and Citrobacter released more SK (16?mg/l from biotite and 12.77?mg/l from muscovite, respectively), the Klebsiella isolates with the highest MBK could release an average of 90?mg/l total K. This study indicated that the assimilated K in microbial cells is the main part of K dissolution from minerals. Due to the fast turnover of nutrients in bacterial biomass, it can be concluded that both SK and MBK could be available for plants. It seems that the finding of this research should be considered in the isolation of KRB.

Highlights

• This study reports, assessment of soluble and biomass K in the culture medium is a reliable tool for estimation of K releasing efficiency of bacteria

• Our results from in vitro experiments revealed that the assimilated K in microbial cells is the main part of K dissolved from minerals.

• Although some genera such as Azotobacter released more K in solution phase, the Klebsiella isolates with the highest biomass K could release more total K

     

Purification of clinical-grade disulfide stabilized antibody fragment variable—Pseudomonas exotoxin conjugate (dsFv-PE38) expressed in Escherichia coli

Immunotoxins are rationally designed cancer targeting and killing agents. Disulfide stabilized antibody Fv portion—toxin conjugates (dsFv-toxin) are third generation immunotoxins containing only the antibody fragment variable portions and a toxin fused to the V_H or V_L. Pseudomonas exotoxin fragment (PE-38) is a commonly used toxin in immunotoxin clinical trials. dsFv-toxin purification was previously published, but the recovery was not satisfactory. This report describes the development of a cGMP production process of the dsFv-toxin that incorporated a novel purification method. The method has been successfully applied to the clinical manufacturing of two dsFv-PE38 immunotoxins, MR1-1 targeting EGFRvIII and HA22 targeting CD22. The two subunits, V_L and V_H PE-38 were expressed separately in Escherichia coli using recombinant technology. Following cell lysis, inclusion bodies were isolated from the biomass harvested from fermentation in animal source component-free media. The dsFv-toxin was formed after denaturation and refolding, and subsequently purified to homogeneity through ammonium sulfate precipitation, hydrophobic interaction and ion-exchange chromatography steps. It was shown, in a direct comparison experiment using MR1-1 as model protein, that the recovery from the new purification method was improved three times over that from previously published method. The improved recovery was also demonstrated during the clinical production of two dsFv-PE38 immunotoxins—MR1-1 and HA22.     

Examination of Duct Physiology in the Human Mammary Gland

BackgroundThe human breast comprise several ductal systems, or lobes, which contain a small amount of fluid containing cells, hormones, proteins and metabolites. The complex physiology of these ducts is likely a contributing factor to the development of breast cancer, especially given that the vast majority of breast cancers begin in a single lobular unit.MethodsWe examined the levels of total protein, progesterone, estradiol, estrone sulfate, dehydroepiandrosterone sulfate, and macrophages in ductal fluid samples obtained from 3 ducts each in 78 women, sampled twice over a 6 month period. Samples were processed for both cytological and molecular analysis. Intraclass correlation coefficients and mixed models were utilized to identify significant data.ResultsWe found that the levels of these ductal fluid components were generally uncorrelated among ducts within a single breast and over time, suggesting that each lobe within the breast has a distinct physiology. However, we also found that estradiol was more correlated in women who were nulliparous or produced nipple aspirate fluid.ConclusionsOur results provide evidence that the microenvironment of any given lobular unit is unique to that individual unit, findings that may provide clues about the initiation and development of ductal carcinomas.     

Efficacy,Safety and Cost of Insecticide Treated Wall Lining,Insecticide Treated Bed Nets and Indoor Wall Wash with Lime for Visceral Leishmaniasis Vector Control in the Indian Sub-continent: A Multi-country Cluster Randomized Controlled Trial

BackgroundWe investigated the efficacy, safety and cost of lime wash of household walls plus treatment of sand fly breeding places with bleach (i.e. environmental management or EM), insecticide impregnated durable wall lining (DWL), and bed net impregnation with slow release insecticide (ITN) for sand fly control in the Indian sub-continent.MethodsThis multi-country cluster randomized controlled trial had 24 clusters in each three sites with eight clusters per high, medium or low sand fly density stratum. Every cluster included 45–50 households. Five households from each cluster were randomly selected for entomological measurements including sand fly density and mortality at one, three, nine and twelve months post intervention. Household interviews were conducted for socioeconomic information and intervention acceptability assessment. Cost for each intervention was calculated. There was a control group without intervention.FindingsSand fly mortality [mean and 95%CI] ranged from 84% (81%-87%) at one month to 74% (71%-78%) at 12 months for DWL, 75% (71%-79%) at one month to 49% (43%-55%) at twelve months for ITN, and 44% (34%-53%) at one month to 22% (14%-29%) at twelve months for EM. Adjusted intervention effect on sand fly density measured by incidence rate ratio ranged from 0.28 (0.23–0.34) at one month to 0.62 (0.51–0.75) at 12 months for DWL; 0.72 (0.62–0.85) at one month to 1.02 (0.86–1.22) at 12 months for ITN; and 0.89 (0.76–1.03) at one months to 1.49 (1.26–1.74) at 12 months for EM. Household acceptance of EM was 74% compared to 94% for both DWL and ITN. Operational cost per household in USD was about 5, 8, and 2 for EM, DWL and ITN, respectively. Minimal adverse reactions were reported for EM and ITN while 36% of households with DWL reported transient itching.InterpretationDWL is the most effective, durable and acceptable control method followed by ITN. The Visceral Leishmaniasis (VL) Elimination Program in the Indian sub-continent should consider DWL and ITN for sand fly control in addition to IRS.