Stepwise development of structure–activity relationship of diverse PARP-1 inhibitors through comparative and validated in silico modeling techniques and molecular dynamics simulation

Inhibitors of poly (ADP-ribose) polymerase-1 (PARP-1) enzyme are useful for the treatment of various diseases including cancer. Comparative in silico studies were performed on different ligand-based (2D-QSAR, Kernel-based partial least square (KPLS) analysis, Pharmacophore Search Engine (PHASE) pharmacophore mapping), and structure-based (molecular docking, MM-GBSA analyses, Gaussian-based 3D-QSAR analyses on docked poses) modeling techniques to explore the structure–activity relationship of a diverse set of PARP-1 inhibitors. Two-dimensional (2D)-QSAR highlighted the importance of charge topological index (JGI7), fractional polar surface area (Jurs_FPSA3), and connectivity index (CIC2) along with different molecular fragments. Favorable and unfavorable fingerprints were demonstrated in KPLS analysis, whereas important pharmacophore features (one acceptor, one donor, and two ring aromatic) along with favorable and unfavorable field effects were demonstrated in PHASE-based pharmacophore model. MM-GBSA analyses revealed significance of different polar, non-polar, and solvation energies. Docking-based alignment of ligands was used to perform Gaussian-based 3D-QSAR study that further demonstrated importance of different field effects. Overall, it was found that polar interactions (hydrogen bonding, bridged hydrogen bonding, and pi–cation) play major roles for higher activity. Steric groups increase the total contact surface area but it should have higher fractional polar surface area to adjust solvation energy. Structure-based pharmacophore mapping spotted the positive ionizable feature of ligands as the most important feature for discriminating highly active compounds from inactives. Molecular dynamics simulation, conducted on highly active ligands, described the dynamic behaviors of the protein complexes and supported the interpretations obtained from other modeling analyses. The current study may be useful for designing PARP-1 inhibitors.     

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Genetic enhancement of host plant-resistance of the Lalat cultivar of rice against bacterial blight employing marker-assisted selection

To incorporate durable resistance against bacterial blight, a major disease rice, three resistance genes, xa 5, xa13 and Xa21, from IRBB 60 were transferred through marker-assisted backcrossing using RG 556, RG 136 and pTA248 markers linked to the three genes to supplement the Xa4 gene present in Lalat, a popular rice cultivar. Effective selection enabled the transfer in three back-crosses and a generation of selfing and background selection employing morphological and grain quality traits and molecular markers, led to >90 % recovery of the recurrent parental genome. The gene pyramids exhibited high levels of resistance against the pathogen in multi-location evaluation trials conducted over several locations of bacterial blight in India. IL-2 (CRMAS2621-7-1), a gene pyramid, was identified as being promising for several endemic regions of bacterial blight and was released as Improved Lalat in one of the identified regions. The success of the study demonstrates the vast potential of marker-assisted selection for gene stacking and recovery of the parental genome with high precision.     

Adhesion of Dissimilatory Fe(III)-Reducing Bacteria to Fe(III) Minerals

The metabolism of dissimilatory iron-reducing bacteria (DIRB) may provide a means of remediating contaminated subsurface soils. The factors controlling the rate and extent of bacterial F(III) mineral reduction are poorly understood. Recent research suggests that molecular-scale interactions between DIRB cells and Fe(III) mineral particles play an important role in this process. One of these interactions, cell adhesion to Fe(III) mineral particles, appears to be a complex process that is, at least in part, mediated by a variety of surface proteins. This study examined the hypothesis that the flagellum serves as an adhesin to different Fe(III) minerals that range in their surface area and degree of crystallinity. Deflagellated cells of the DIRB Shewanella algae BrY showed a reduced ability to adhere to hydrous ferric oxide (HFO) relative to flagellated cells. Flagellated cells were also more hydrophobic than deflagellated cells. This was significant because hydrophobic interactions have been previously shown to dominate S. algae cell adhesion to Fe(III) minerals. Pre-incubating HFO, goethite, or hematite with purified flagella inhibited the adhesion of S. algae BrY cells to these minerals. Transposon mutagenesis was used to generate a flagellum-deficient mutant designated S. algae strain NF. There was a significant difference in the rate and extent of S. algae NF adhesion to HFO, goethite, and hematite relative to that of S. algae BrY. Amiloride, a specific inhibitor of Na + -driven flagellar motors, inhibited S. algae BrY motility but did not affect the adhesion of S. algae BrY to HFO. S.algae NF reduced HFO at the same rate as S. algae BrY. Collectively, the results of this study support the hypothesis that the flagellum of S. algae functions as a specific Fe(III) mineral adhesin. However, these results suggest that flagellum-mediated adhesion is not requisite for Fe(III) mineral reduction.     

Oncolytic Vesicular Stomatitis Virus in an Immunocompetent Model of MUC1-Positive or MUC1-Null Pancreatic Ductal Adenocarcinoma

Vesicular stomatitis virus (VSV) is a promising oncolytic agent against various malignancies. Here, for the first time, we tested VSV in vitro and in vivo in a clinically relevant, immunocompetent mouse model of pancreatic ductal adenocarcinoma (PDA). Our system allows the study of virotherapy against PDA in the context of overexpression (80% of PDA patients) or no expression of human mucin 1 (MUC1), a major marker for poor prognosis in patients. In vitro, we tested three VSV recombinants, wild-type VSV, VSV-green fluorescent protein (VSV-GFP), and a safe oncolytic VSV-ΔM51-GFP, against five mouse PDA cell lines that either expressed human MUC1 or were MUC1 null. All viruses demonstrated significant oncolytic abilities independent of MUC1 expression, although VSV-ΔM51-GFP was somewhat less effective in two PDA cell lines. In vivo administration of VSV-ΔM51-GFP resulted in significant reduction of tumor growth for tested mouse PDA xenografts (+MUC1 or MUC1 null), and antitumor efficacy was further improved when the virus was combined with the chemotherapeutic drug gemcitabine. The antitumor effect was transient in all tested groups. The developed system can be used to study therapies involving various oncolytic viruses and chemotherapeutics, with the goal of inducing tumor-specific immunity while preventing premature virus clearance.     

Fatty acid-induced angiogenesis in first trimester placental trophoblast cells: Possible roles of cellular fatty acid-binding proteins

Angiogenesis is involved in the growth of new blood vessels from the existing one. Consequently, angiogenesis plays an indispensable role in tissue growth and repair including early placentation processes. Besides angiogenic growth factors (vascular endothelial growth factor (VEGF), angiopoietin-like 4 (ANGPTL4), placental growth factor (PlGF), platelet derived growth factor (PDGF), fibroblast growth factors (FGF)), dietary fatty acids (c>16) also directly or indirectly modulate angiogenic processes in tumors and other cell systems. Usually n − 3 fatty acids inhibit whereas n − 6 fatty acids stimulate angiogenesis in tumors and other cells. Contrary to this, docosahexaenoic acid, 22:6n − 3 (DHA) and other fatty acids including conjugated linoleic acid stimulate angiogenesis in placental first trimester cells. In addition to the stimulation of expression of major angiogenic factors such as VEGF and ANGPTL4, fatty acids also stimulate expression of intracellular fatty acid-binding proteins (FABPs) FABP-4 and FABP-3 those are known to directly modulate angiogenesis. Emerging data indicate that FABPs may be involved in the angiogenesis process. This paper reviews the fatty acid mediated angiogenesis process and the involvement of their binding proteins in these processes.     

An ecological perspective on marine reserves in prey–predator dynamics

This paper describes a prey–predator type fishery model with prey dispersal in a two-patch environment, one of which is a free fishing zone and other is a protected zone. The existence of possible steady states, along with their local stability, is discussed. A geometric approach is used to derive the sufficient conditions for global stability of the system at the positive equilibrium. Relative size of the reserve is considered as control in order to study optimal sustainable yield policy. Subsequently, the optimal system is derived and then solved numerically using an iterative method with Runge–Kutta fourth-order scheme. Numerical simulations are carried out to illustrate the importance of marine reserve in fisheries management. It is noted that the marine protected area enables us to protect and restore multi-species ecosystem. The results illustrate that dynamics of the system is extremely interesting if simultaneous effects of a regulatory mechanism like marine reserve is coupled with harvesting effort. It is observed that the migration of the resource, from protected area to unprotected area and vice versa, is playing an important role towards the standing stock assessment in both the areas which ultimately control the harvesting efficiency and enhance the fishing stock up to some extent.