DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Protection against acute paraquat toxicity by ambroxol

An expression vector for G-CSF, pASLB3-3, was constructed and introduced into Namalwa KJM-1 cells (Hosoi et al., 1988), and cells resistant to 100 nM of methotrexate (MTX) were obtained. Among them, the highest producer, clone SC57, was selected and the productivity of this clone was further characterized. The maximal production of G-CSF was at the most 1.8 g/ml/day using a 25 cm² tissue culture flask, even though the cell number was above 7×10⁵ cells/ml. The limiting factors at high density were analyzed as the deficiency of nutrients, such as glucose, cysteine and serine, and pH control. The depression of specific G-CSF productivity per cell under the batch culture conditions was overcome by using a perfusion culture system, Biofermenter^TM (Sato, 1983) with modifications of nutrients supplementation by a dialysis membrane and/or dissolved oxygen (DO) supplementation by microsilicone fibers. ITPSGF medium was modified to elevate concentrations of amino acids and glucose by 2.0- and 2.5-times, respectively. Under the control of pH at 7.4 and DO at 3 ppm, the specific G-CSF productivity was not depressed even at high cell density (above 1×10⁷ cells/ml), and the amount of G-CSF reached 41 g/ml. These results indicated the possibility of finding the optimum culture conditions for the production of recombinant proteins by Namalwa KJM-1 cells.Abbreviations ABTS 2,2-Azino-di-(3-ethylbenzothiazoline)-6-sulfonic acid - BSA Bovine Serum Albumin - BSA-PBS Phosphate-buffered Saline without Ca²⁺ and Mg²⁺ containing Bovine Serum Albumin - dhfr Dihydrofolate Reductase - DO Dissolved Oxygen - G-CSF Granulocyte Colony-stimulating Factor - HEPES 4-(2-Hydroxyethyl)-1-piperazineethansulfonic Acid - IFN Interferon - MTX Methotrexate - PBS(-) Phosphate-buffered saline without Ca²⁺ and Mg²⁺ - Tween-PBS Phosphate-buffered saline without Ca²⁺ and Mg²⁺ containing 0.05% of Tween 20     

Expression of anchorin CII mRNA by cultured chondrocytes

The establishment of a cell culture system promoting chondrocyte differentiation has been utilized to better characterize phenotypic stages of chondrogenesis at the cellular level. Although the expression of the type II collagen gene has been studied during “in vitro” chondrocyte differentiation, little is known about the expression of the gene coding for its receptor: anchorin CII. The modulation of the anchorin mRNA steady state level in chick embryo chondrocytes at different developmental stages is described here.The anchorin mRNA level was low in dedifferentiated chondrocytes, progressively increased after the cell transfer into suspension (a condition promoting differentiation), reached its maximal value after 4 weeks and decreased after 5 weeks.Therefore anchorin CII mRNA reaches its maximum level in hypertrophic stage II chondrocytes.     

Molecular Evidence and the Origin and Development of the Domesticated Sunflower (<Emphasis Type="Italic">Helianthus annum</Emphasis>, Asteraceae)

The domesticated sunflower,Helianthus annuus, is an important economic crop, yet molecular data regarding its evolution are limited. Here we review morphological, geographical, archaeological, and molecular evidence pertaining to its origin and development. New isozyme and chloroplast DNA (cpDNA) evidence is also presented.Morphological, geographical, and archaeological evidence has led to the hypothesis that the domesticated sunflower was derived from a wild/weedy form ofH. annuus possibly in the Midwest. Molecular evidence was concordant with this hypothesis. A high degree of enzymatic and cpDNA sequence similarity was observed between wild and domesticatedH. annuus, and domesticatedH. annuus contained a subset of the alleles and cpDNAs found in wildH. annuus. The extensive polymorphism in the wild plants and the virtual monomorphism in cultivated lines for both isozyme and cpDNA phenotypes further suggest a single origin of the domesticated sunflower from a very limited gene pool. In addition, Native American varieties of the domesticated sunflower were genetically more variable than other cultivated lines, possibly indicating that they gave rise to the other cultivated stocks. Molecular evidence did not, however, allow conclusions as to the exact geographic origin of the domesticated sunflower.     

Studies on the hydrolysis of 3-methyl-2′-deoxycytidine in aqueous solution A synthesis of 3-methyl-2′-deoxyuridine

The hydrolysis of 3-methyl-2′-deoxycytidine in aqueous solution has been investigated. Varying proportions of 3-methylcytosine, 3-methyluracil and 3-methyl-2′-deoxyuridine are formed depending upon conditions of pH and temperature. All three hydrolytic products are formed at pH 6.8 and 90°C. At pH 2, depyrimidination of 3-methylcytosine occurs as the only hydrolysis product. When the pH is increased to 12, 3-methyl-2′-deoxycytidine on heating at 90°C is completely deaminated to 3-methyl-2′-deoxyuridine with few side products formed. This reaction serves as the basis for a convenient synthesis of 3-methyl-2′-deoxyuridine. The 300 MHz spectra of 3-methyl-2′-deoxycytidine and 3-methyl-2′-deoxyuridine indicate that the sugar ring in these compounds is predominantly in ²E conformation.     

Decreased alpha 1-adrenoceptor responsiveness and density in liver cells of thyroidectomized rats

The effects of hypothyroidism on the hepatic alpha 1-receptor system were studied in isolated rat liver cells. Phenylephrine and vasopressin caused concentration-dependent activation of glycogen phosphorylase and release of 45Ca from 45Ca-loaded cells in either normal or thyroidectomized rats. However, the magnitude of both responses to phenylephrine was markedly suppressed after thyroidectomy and could be restored to near normal levels by in vivo treatment with 1-triiodothyronine (0.25 mg/kg/day) for 4 days. The potency of vasopressin to induce phosphorylase activation and 45Ca release was only slightly reduced by thyroidectomy. Binding of [3H]prazosin to putative alpha 1-receptors in purified liver plasma membranes revealed that the above changes were accompanied by a decrease in the density of binding sites from 567 +/- 51 fmol/mg of protein in controls to 326 +/- 51 fmol/mg in thyroidectomized rats and a return to 498 +/- 23 fmol/mg in thyroidectomized rats treated with 1-triiodothyronine. The affinity of binding sites for [3H]prazosin or for alpha-receptor agonists was the same in the three groups of rats and affinity for epinephrine was unaffected by the presence of guanyl-5'-yl imidodiphosphate (30-100 microM). From these findings, it appears that a reduction in the number of hepatic alpha 1-receptors is responsible for the selective decrease in alpha-adrenergic responses in the hypothyroid rat liver. These changes are opposite to those previously reported for hepatic beta-receptors.     

The Light-harvesting Chlorophyll a/b-Protein Complex of Chlamydomonas reinhardii

The molecular organization of chlorophyll in Chlamydomonas reinhardii has been shown to be essentially similar to that in higher plants. Some 50% of the chlorophyll in Chlamydomonas reinhardii chloroplast membranes has been shown to be located in a chlorophyll a/b-protein complex. The complex was isolated in a homogeneous form by hydroxylapatite chromatography of sodium dodecyl sulfate extracts of the chloroplast membranes. Its absorption spectrum exhibits two maxima in the red region at 670 and 652 nm due to the presence of equimolar quantities of chlorophylls a and b in the complex. Preparations of the chlorophyll-protein also contain some of each of the carotenoids observed in the intact chloroplast membrane, but not in the same proportions. The native complex (S value = 2.3S) exhibits a molecular weight of 28,000 ± 2,000 on calibrated sodium dodecyl sulfate-polyacrylamide gel electrophoresis. However, on the basis of its amino acid composition and other data a more probable molecular weight of about 35,000 was calculated. Each 35,000 dalton unit contains three chlorophyll a and three chlorophyll b molecules, and on the average one carotenoid molecule conjugated with probably a single polypeptide of 29,000 daltons. Comparison of spectral and biochemical characteristics demonstrates that this algal chlorophyll-protein is homologous to the previously described major light-harvesting chlorophyll a/b-protein of higher plants. It is anticipated that the Chlamydomonas complex functions solely in a light-harvesting capacity in analogy to the function determined for the higher plant component.     

Hereditary respiration deficiency in Saccharomycodes ludwigii

Saccharomycodes ludwigii, supposed to be petite-negative, gave rise to respiration-deficient mutants when acriflavine and ultraviolet irradiation, respectively, were applied to this yeast, strain IFO 1194. The frequency of such mutants was very low as compared with that in Saccharomyces cerevisiae and other petite-positive yeasts. Cytochrome composition was characterized by spectrophotometry at the temperature of liquid nitrogen. The respiratory mutants examined contained cytochrome c unaltered in quality and quantity. Cytochrome b was often present only in small amounts though never absent, while cytochrome a+a₃ was either present or absent. The respiratory mutants could form zygotes after conjugation with a wild-type culture of opposite mating type ( vs. a). The hybridization and segregation analysis of spore tetrads showed the inheritance of respiratory mutant character to be either Mendelian or non-Mendelian and similar to that of pet (nuclear) and rho^- (cytoplasmic) mutants, respectively, in Saccharomyces cerevisiae.     

T-rosettes in hemodialysis patients and renal allograft recipients

Subcellular fractions, isolated from the lymphoid cell line IM-1, are capable of stimulating a weak proliferative response in allogeneic lymphocytes. They also stimulate the generation of cytotoxic effector lymphocytes. The proliferative response to subcellular fractions, as measured by ³H-thymidine incorporation, is only one-fourth to one-sixth as great as that to intact IM-1 cells, suggesting that a component(s) synthesized during the mixed lymphocyte reaction (MLR), or a short-lived cellular constituent, may be responsible for the ability of intact cells to stimulate a lymphocyte proliferative response. This component appears to be lacking or in limiting quantity in subcellular fractions, including the soluble fractions. In contrast to the decreased proliferative response to subcellular fractions, the cytotoxic capacity of the stimulated lymphocytes is comparable to that after stimulation by intact IM-1 cells. The data demonstrate that, in this system, cytotoxic effector lymphocytes can be generated in the absence of the extensive proliferative response normally observed in the MLR. The antigenic stimulus responsible for the generation of cytotoxic effector cells appears to reside on intracellular components as well as on plasma membrane. In these reactions, specificity is shown by the failure of the cytotoxic cells to release ⁵¹Cr from autologous target cells. In fact, reactivity of lymphocytes stimulated by subcellular fractions is more specific than the reactivity of cells stimulated by intact IM-1 as judged by their lytic capacity for another target cell, RPMI 4265.