Fertilization and early development in Beroe ovata

Fertilization in the clear egg (1 mm in diameter) of the ctenophore Beroe ovata and, in particular, the positioning and movements of pronuclei, and their relationship to the larval oral-aboral axis have been observed. Fertilization can take place anywhere on the egg surface. The sperm pronucleus remains at its entry site and becomes surrounded by a specialized zone (30–50 μm in diameter) beneath the surface referred to as the sperm pronuclear zone or SPZ and devoid of large cortical granules. Polyspermy has been observed to be frequent; each pronucleus is surrounded by its own SPZ. Only the egg pronucleus migrates with a continuous velocity (averaging 18 μm/min) and moves beneath the surface directly toward the immobile sperm pronucleus. In polyspermic eggs, the egg pronucleus can probe several SPZ, each containing a single sperm nucleus, before it finally enters one SPZ and fuses with the chosen sperm pronucleus. These migrations of the egg pronucleus occur over several millimeters and take hours, but the mechanism underlying the motion or how the egg pronucleus decides which SPZ to enter is not yet known. Under our experimental conditions the mitotic apparatus and the first cleavage plane which defines the oral-aboral axis of the larva (see Reverberi (1971). “Experimental Embryology of Marine and Fresh-Water Invertebrates.” North-Holland, Amsterdam. for review) pass through the point of sperm entry. During fertilization and cleavage, movements of a cortical autofluorescent material are clearly seen. This material is segregated into micromeres as cleavage progresses.     

Candidose et tumeur obstructive intestinales chez un Babouin captif, ‘Papio Papio’ (Desm.)

Résumé Une candidose intestinale associée à une tumeur épithéliale, à métaplasie glandulaire, à pouvoir invasif marqué, provoquant une gêne du transit, a été découverte chez un Babouin de Guinée,Papio papio (Desm.) de la collection du Parc zoologique de Paris. A cette occasion nous avons rapporté les résultats concernant deux autres affections du tube digestid de nos Babouins captifs.

---

Report of a case of candidiasis of the digestive tract associated to an obstructive epithelial tumor, with great invasive ability, in a captive Baboon,Papio papio (Desm.). Included is a discussion of the incidence of some intestinal disturbances involving candidiasis of subhuman Primates.

     

Specific binding and pharmacological interactions of apamin,the neurotoxin from bee venom,with guinea pig colon

This paper describes the interaction of apamin, the bee venom neurotoxin, with its receptor in the guinea pig colon. The pharmacological activity of the toxin was assayed by measuring its contracting effect on guinea pig colon preparations that had been previously relaxed by neurotensin. The IC₅₀ value of apamin in this $\text{in vitro}$ bioassay is 7 nM. These pharmacological data are compared to the binding properties of apamin to smooth muscle membranes prepared from guinea pig colon. The highly radiolabeled monoiododerivative of apamin binds to its colon receptor with a dissociation constant $\text{K}{}_{\mathrm{<mtext>d</mtext>}}{}^1\text{= 36}\text{pM}$. The maximal binding capacity of colonic membranes is 30^dfmol/mg of protein. The dissociation constant of the unmodified toxin is 23 pM. The difference between the toxin concentrations that produce half-maximal effects in the binding and pharmacological studies arises from the different experimental conditions used for the two assays.     

Further observations on cell wall morphogenesis and polysaccharide arrangement during plant growth

Summary The three-dimensional arrangement of the polysaccharide chains in cell walls was investigated, using ultracryotomy and cytochemistry, in order to test the validity of the previously postulated ordered fibril hypothesis and to analyze the characteristics of the primary wall morphogenesis.Both in mung bean hypocotyl (Phaseolus aureus) and pea root (Pisum sativum) cultured in defined conditions, cell to cell endogenous specificity is marked by differences in the numbers of layers, thickness, rhythm and direction of deposition. The occurrence of bow-shaped arrangements and of strata of orientation intermediate between the main crisscrossed multifibrillar layers suggests that the sequential changes of the morphogenetic activity of the cells is progressive. The twisted polysaccharide disposition evokes certain mesomorphic states; a part of the mechanism responsible for the wall arrangement may result from a self-assembly process as in the orientation of the molecules in a liquid cristal. This possibility finds experimental support in the fact that a three-dimensional association of the hemicellulose chains spontaneously appears when precipitated in acellular conditions.Polysaccharide removal associated with shadowing indicates that the ordered disposition within the wall is extensively altered by even a slight extraction. These data may invalidate diverse results which are generally brought forward to explain the wall organization during growth.     

The role of glucagon in the regulation of blood glucose: Model studies

Mathematical models afford a procedure of unifying concepts and hypotheses by expressing quantitative relationships between observables. The model presented indicates the roles of both insulin and glucagon as regulators of blood glucose, albeit in different ranges of the blood glucose concentrations. Insulin secretion is induced during hyperglycemia, while glucagon secretion results during hypoglycemia. These are demonstrated by simulations of a mathematical model conformed to data from the oral glucose tolerance test and the insulin infusion test in normal control subjects and stable and unstable diabetic patients. The model studies suggest the parameters could prove of value in quantifying the diabetic condition by indicating the degree of instability. Presented at the Society for Mathematical Biology Meeting, University of Pennsylvania, Philadelphia, August 19–21, 1976.     

Cellulose acetate electrophoresis of protein kinases: Detection of the active forms using various substrates

Electrophoresis on cellulose acetate strips was used to analyze protein kinases from normal rat liver. In addition to already well-characterized cAMP-dependent protein kinases type I and II and cAMP-independent casein kinases I and II, this method enabled the detection of several supplementary bands corresponding to kinases which were investigated according to their substrate specificity, activation by cAMP, and inhibition by the specific inhibitor of the catalytic subunit of cAMP-dependent protein kinases or by heparin. Using this rapid, sensitive, and resolutive electrophoretic method, different isozyme patterns could be obtained starting from minute amounts of different types of biological material.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër