Chromosome 6p influences on different dyslexia-related cognitive processes: further confirmation

In this study, which is a continuation and an extension of an earlier study, we enrolled two new families (N=31) and recruited more individuals from the previously ascertained families (N=56). The eight multiplex families (N=171) presented in this study were ascertained from a sample of adult probands whose childhood reading history is well documented through archival information. Six phenotypes were constructed to span a range of dyslexia-related cognitive processes. These phenotypes were (1) phonemic awareness (of spoken words); (2) phonological decoding (of printed nonwords); (3) rapid automatized naming (of colored squares or object drawings); (4) single-word reading (orally, of printed real words); (5) vocabulary; and (6) spelling (of dictated words). In addition, the diagnosis of lifelong dyslexia was established by clinical means. Genotyping was done with nine highly polymorphic markers from the 6p22.3-6p21.3 region. The results of two- and multipoint identity-by-descent and identity-by-state analyses supported the importance of a putative locus in the D6S464-D6S273 region for a number of dyslexia-related cognitive deficits.     

Melanocortin-1 receptor polymorphisms and risk of melanoma: is the association explained solely by pigmentation phenotype?

Risk of cutaneous malignant melanoma (CMM) is increased in sun-exposed whites, particularly those with a pale complexion. This study was designed to investigate the relationship of the melanocortin-1 receptor (MC1R) genotype to CMM risk, controlled for pigmentation phenotype. We report the occurrence of five common MC1R variants in an Australian population-based sample of 460 individuals with familial and sporadic CMM and 399 control individuals-and their relationship to such other risk factors as skin, hair, and eye color; freckling; and nevus count. There was a strong relationship between MC1R variants and hair color and skin type. Moreover, MC1R variants were found in 72% of the individuals with CMM, whereas only 56% of the control individuals carried at least one variant (P<.001), a finding independent of strength of family history of melanoma. Three active alleles (Arg151Cys, Arg160Trp, and Asp294His), previously associated with red hair, doubled CMM risk for each additional allele carried (odds ratio 2.0; 95% confidence interval 1. 6-2.6). No such independent association could be demonstrated with the Val60Leu and Asp84Glu variants. Among pale-skinned individuals alone, this association between CMM and MC1R variants was absent, but it persisted among those reporting a medium or olive/dark complexion. We conclude that the effect that MC1R variant alleles have on CMM is partly mediated via determination of pigmentation phenotype and that these alleles may also negate the protection normally afforded by darker skin coloring in some members of this white population.     

An NMR and molecular modeling study of the site-specific binding of histamine by heparin, chemically modified heparin, and heparin-derived oligosaccharides

The diprotonated form of histamine binds site-specifically to heparin, a highly sulfated 1-->4 linked repeating copolymer comprised predominantly of 2-O-sulfo-alpha-L-iduronic acid (the I ring) and 2-deoxy-2-sulfamido-6-O-sulfo-alpha-D-glucopyranosyl (the A ring). The binding is mediated by electrostatic interactions. The structural features of histamine and heparin, which are required for the site-specific binding, have been identified from the results of (1)H NMR studies of the binding of histamine by six heparin-derived oligosaccharides and four chemically modified heparins and molecular modeling studies. The results indicate that the imidazolium ring of diprotonated histamine is critical for directing site-specific binding, while the ammonium group increases the binding affinity. The imidazolium ring binds within a cleft, with the A ring of an IAI triad at the top of the cleft, and the I rings forming the two sides. The H3 proton of the A ring is in the shielding cone of the imidazolium ring. The carboxylate group of the I-ring at the reducing end of the IAI triad and possibly the sulfamido group of the A-ring are essential for site-specific binding, whereas the 2-O-sulfate group of the I ring and the 6-O-sulfate group of the A ring are not. The results indicate that histamine binds to the IAI triad with the I rings in the (1)C(4) conformation. Also, the configuration of the carboxylate group is critical, as indicated by the absence of site-specific binding of histamine by the related IAG sequence, where G is alpha-D-glucuronic acid. The molecular modeling results indicate that the N1H and N3H protons of the imidazolium ring of site-specifically bound histamine are hydrogen bonded to the carboxylates of the I rings at the nonreducing and reducing ends of the IAI trisaccharide sequence.     

August Weismann's concept of germ plasma as the basic reason for the inadequacy of neo-Darwinism

Neo-Darwinism is a result of synthesis of Darwinian concept of natural selection with Weismannian concept of germ plasma. The concept of germ plasma is based on a hypothesis that phenotypic traits are completely determined by genes. Hence, neo-Darwinism describes evolution as a process of alternation of gene frequencies under the effect of natural selection. This is an inadequate approach to the study of evolution. In the course of evolution, genes change their functions, whereas phenotypic characters change their corresponding genes. As a result, every step of evolutionary transformation changes the structure of phenotype-to-genotype correspondence. Therefore, phenotypic evolution cannot be described in genetic terms, the same as to human languages cannot be translated one into another whenever the meaning of words is constantly changing. Consequently, Weismannian germ-plasma concept adequately describes the relation of characters to genes only during stasis, but is inapplicable to evolution.     

Distinct pathogenesis of hong kong-origin H5N1 viruses in mice compared to that of other highly pathogenic H5 avian influenza viruses

In 1997, an outbreak of virulent H5N1 avian influenza virus occurred in poultry in Hong Kong (HK) and was linked to a direct transmission to humans. The factors associated with transmission of avian influenza virus to mammals are not fully understood, and the potential risk of other highly virulent avian influenza A viruses infecting and causing disease in mammals is not known. In this study, two avian and one human HK-origin H5N1 virus along with four additional highly pathogenic H5 avian influenza viruses were analyzed for their pathogenicity in 6- to 8-week-old BALB/c mice. Both the avian and human HK H5 influenza virus isolates caused severe disease in mice, characterized by induced hypothermia, clinical signs, rapid weight loss, and 75 to 100% mortality by 6 to 8 days postinfection. Three of the non-HK-origin isolates caused no detectable clinical signs. One isolate, A/tk/England/91 (H5N1), induced measurable disease, and all but one of the animals recovered. Infections resulted in mild to severe lesions in both the upper and lower respiratory tracts. Most consistently, the viruses caused necrosis in respiratory epithelium of the nasal cavity, trachea, bronchi, and bronchioles with accompanying inflammation. The most severe and widespread lesions were observed in the lungs of HK avian influenza virus-infected mice, while no lesions or only mild lesions were evident with A/ck/Scotland/59 (H5N1) and A/ck/Queretaro/95 (H5N2). The A/ck/Italy/97 (H5N2) and the A/tk/England/91 (H5N1) viruses exhibited intermediate pathogenicity, producing mild to moderate respiratory tract lesions. In addition, infection by the different isolates could be further distinguished by the mouse immune response. The non-HK-origin isolates all induced production of increased levels of active transforming growth factor beta following infection, while the HK-origin isolates did not.     

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.     

Characterization of promoter function and cell-type-specific expression from viral vectors in the nervous system

Viral vectors have become important tools to effectively transfer genes into terminally differentiated cells, including neurons. However, the rational for selection of the promoter for use in viral vectors remains poorly understood. Comparison of promoters has been complicated by the use of different viral backgrounds, transgenes, and target tissues. Adenoviral vectors were constructed in the same vector background to directly compare three viral promoters, the human cytomegalovirus (CMV) immediate-early promoter, the Rous sarcoma virus (RSV) long terminal repeat, and the adenoviral E1A promoter, driving expression of the Escherichia coli lacZ gene or the gene for the enhanced green fluorescent protein. The temporal patterns, levels of expression, and cytotoxicity from the vectors were analyzed. In sensory neuronal cultures, the CMV promoter produced the highest levels of expression, the RSV promoter produced lower levels, and the E1A promoter produced limited expression. There was no evidence of cytotoxicity produced by the viral vectors. In vivo analyses following stereotaxic injection of the vector into the rat hippocampus demonstrated differences in the cell-type-specific expression from the CMV promoter versus the RSV promoter. In acutely prepared hippocampal brain slices, marked differences in the cell type specificity of expression from the promoters were confirmed. The CMV promoter produced expression in hilar regions and pyramidal neurons, with minimal expression in the dentate gyrus. The RSV promoter produced expression in dentate gyrus neurons. These results demonstrate that the selection of the promoter is critical for the success of the viral vector to express a transgene in specific cell types.     

Synthesis of allysine ethylene acetal using phenylalanine dehydrogenase from Thermoactinomyces intermedius

Allysine ethylene acetal [(S)-2-amino-5-(1,3-dioxolan-2-yl)-pentanoic acid (2)] was prepared from the corresponding keto acid by reductive amination using phenylalanine dehydrogenase (PDH) from Thermoactinomyces intermedius ATCC 33205. Glutamate, alanine, and leucine dehydrogenases, and PDH from Sporosarcina species (listed in order of increasing effectiveness) also gave the desired amino acid but were less effective. The reaction requires ammonia and NADH. NAD produced during the reaction was recyled to NADH by the oxidation of formate to CO(2) using formate dehydrogenase (FDH). PDH was produced by growth of T. intermedius ATCC 33205 or by growth of recombinant Escherichia coli or Pichia pastoris expressing the Thermoactinomyces enzyme. Using heat-dried T. intermedius as a source of PDH and heat-dried Candida boidinii SC13822 as a source of FDH,98%, but production of T. intermedius could not be scaled up. Using heat-dried recombinant E. coli as a source of PDH and heat-dried Candida boidinii 98%. In a third generation process, heat-dried methanol-grown P. pastoris expressing endogenous FDH and recombinant Thermoactinomyces98% ee.