Glycidol-modified gels for molecular-sieve chromatography. Surface hydrophilization and pore size reduction

Divinyl sulfone-crosslinked agarose gels were made hydrophilic by coupling glycidol to the agarose chains. The concentration of glycidol in the reaction mixture determines the pore size of the gels (the glycidol molecules probably form polymers, the degree of polymerization increasing with the glycidol concentration). Gels prepared with moderate glycidol concentrations are still porous enough to be used for separation of proteins and peptides. Gels with a high degree of glycidol polymerization are suited for desalting of low-molecular-weight compounds, for instance peptides.     

Effect of a single neonatal treatment with steroid hormone or steroid-like molecules on myocardial ouabain binding in the adult rat

A single neonatal treatment of rats with vitamin D3, gibberellin, allylestrenol or diethylstilbestrol (DES) influenced the ouabain binding capacity of myocardial Na, K-dependent ATP-ase. Of the active molecules tested, vitamin D3, DES and gibberellin had appreciable impact on myocardial ouabain receptors, enhancing and depressing their activity, respectively. The thymic dexamethasone and uterine estrogen receptors did not alter their binding capacity in response to neonatal exposure to vitamin D3 or gibberellin.     

Calcium in hippocampus following lidocaine induced seizures: an electron cytochemical study

The effect of lidocaine seizures on cellular accumulation of calcium was studied in hippocampal subfields CA1 and CA3 and the dentate gyrus of rats, using the combined oxalate-pyroantimonate method. The specificity of the reaction was ascertained by EGTA treatment and X-ray microanalysis. In control rats, calcium was visualized between myelin lamellae of axons, in synaptic vesicles and in some lysosomes. Two hours after onset of lidocaine seizures selective neuronal degenerations appeared in hippocampal subfields CA1 and CA3 but not in the dentate gyrus. Calcium deposits were present in numerous mitochondria of pyramidal cells and, occasionally, also of neuroglial cells. Many of these mitochondria exhibited ultrastructural alterations. Calcium uptake was most prominent in the CA3 sector but was also present in the CA1 subfield as well as the dentate gyrus. Intracellular calcium uptake, in consequence, is not the unique attribute of selectively vulnerable hippocampal neurons.     

Various characteristics of the structure and synthesis of procollagens produced by cultured skin fibroblasts from patients with Danlos-Ehlers syndrome type I

The electrophoretic mobilities of the collagen and procollagen type I and III chains synthesized by the fibroblasts isolated from patients with type I Ehlers-Danlos syndrome as well as a set of peptides obtained by splitting of pro alpha 1(I) and pro alpha 2(I) type I procollagens by cyanbromide are not different from the normal ones. The fact demonstrates the absence of long insertions or deletions, or the sufficient defects in intracellular chain modifications. The changes were also nor registered for the ratio of type I and III collagens from the digested by pepsin preparations of protein accumulating in the culture media of the cultured skin fibroblasts from patients. The studied strains of cultured fibroblasts from patients suffering the Ehlers-Danlos syndrome have the trend to increased accumulation of partially processed chains of proc alpha 1(I) and proc alpha 2(I) type I procollagen and to the increased ratio of pro alpha 1(I) to pro alpha 2(I).     

The nature of virus strains isolated from patients with poliomyelitis in the Byelorussian SSR 1967-1985

Oligonucleotide mapping of the RNA genome was applied for analysis of poliovirus clinical isolates in Byelorussia in 1967-1985. All the maps have been clearly shown to resemble the reference maps of the corresponding vaccine strains. Examination of the oligonucleotide maps of poliovirus isolates provides a measure of distribution of some of the mutations over the viral genome.     

A sensitive high performance liquid chromatographic method for determining small amounts of glycosylproteins

We developed a simple isocratic high performance liquid chromatography (HPLC) method for the quantitative determination of 5-hydroxymethyl-2-furfuraldehyde (5-HMF) liberated by mild hydrolysis of small amounts of glycosyl proteins. The absorbance of hydrolysate components after HPLC separation was recorded at 280 nm. To detect substances possibly interfering with the 5-HMF peak we always recorded the ratio of the peak heights A280 nm/A254 nm which was a constant value of 4.4. For each sample the blank was obtained by reduction with NaBH4 before hydrolysis with oxalic acid 1 mol/l. The best NaBH4/protein ratio was found to be 4 mg/mg. With this method we measured the nonenzymatic glycosylation (glycation) as 5-HMF in samples with a protein concentration as low as 0.8 mg/ml. 5-HMF produced per milligram of protein was independent from protein concentration for a wide range (0.8-10 mg/ml). The mean coefficient of variation for within assay and between precision was 6.8 and 11.6%, respectively. The 5-HMF measured on plasma proteins from normal subjects (n = 7) was 0.16 +/- 0.04 nmol/mg. Protein from insulin-dependent diabetic patients was 0.31 +/- 0.07 nmol/mg. With this method we succeeded in detecting an excessive glycation of platelet membrane proteins in 13 type-I diabetic patients.     

Inhibition of human natural killer activity by monolayers of primary cell cultures

Some primary and continuous cell cultures were tested for their capacity to regulate human natural killer (NK) activity. Primary cultures of endothelial cells, fetal fibroblasts, adult fibroblasts, amnion epithelial cells, renal parenchymal cells, and ovarian carcinoma cells inhibited NK activity when peripheral blood lymphocytes were preincubated on target cell monolayers for 18 h before testing the cytotoxicity against K-562. The supernatants of the inhibiting cell cultures were not suppressive. Prostaglandins or suppressive lymphocytes were not involved in the phenomenon. The binding capacity of the effector cells was not changed, suggesting that the suppressive signal was targeted at the cytolytic machinery of NK cells. The down-regulating capacity of the cell cultures weakened significantly during subculturing in vitro, and continuous cell lines were not inhibitory. The inactivation of NK cells may be one of the mechanisms by which target cells are protected from NK activity.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

The crystal structure of the beta-lactamase of Streptomyces albus G at 0.3 nm resolution.

The crystal structure of the beta-lactamase of Streptomyces albus G has been solved at 0.3 nm resolution by X-ray-diffraction methods. The enzyme is a typical two-domain protein. One domain consists of five alpha-helices, and the other is five-stranded beta-sheet with alpha-helices on both sides of the sheet. The active-site serine residue (Ser-48) is within a cleft located between the two domains.