Genome Wide Host Gene Expression Analysis in Chicken Lungs Infected with Avian Influenza Viruses

The molecular pathogenesis of avian influenza infection varies greatly with individual bird species and virus strain. The molecular pathogenesis of the highly pathogenic avian influenza virus (HPAIV) or the low pathogenic avian influenza virus (LPAIV) infection in avian species remains poorly understood. Thus, global immune response of chickens infected with HPAI H5N1 (A/duck/India/02CA10/2011) and LPAI H9N2 (A/duck/India/249800/2010) viruses was studied using microarray to identify crucial host genetic components responsive to these infection. HPAI H5N1 virus induced excessive expression of type I IFNs (IFNA and IFNG), cytokines (IL1B, IL18, IL22, IL13, and IL12B), chemokines (CCL4, CCL19, CCL10, and CX3CL1) and IFN stimulated genes (OASL, MX1, RSAD2, IFITM5, IFIT5, GBP 1, and EIF2AK) in lung tissues. This dysregulation of host innate immune genes may be the critical determinant of the severity and the outcome of the influenza infection in chickens. In contrast, the expression levels of most of these genes was not induced in the lungs of LPAI H9N2 virus infected chickens. This study indicated the relationship between host immune genes and their roles in pathogenesis of HPAIV infection in chickens.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Utility of MLPA in mutation analysis and carrier detection for Duchenne muscular dystrophy

CONTEXT:

Multiplex ligation probe amplification (MLPA) is a new technique to identify deletions and duplications and can evaluate all 79 exons in dystrophin gene in patients with Duchenne muscular dystrophy (DMD). Being semi-quantitative, MLPA is also effective in detecting duplications and carrier testing of females; both of which cannot be done using multiplex PCR. It has found applications in diagnostics of many genetic disorders.

AIM:

To study the utility of MLPA in diagnosis and carrier detection for DMD.

MATERIALS AND METHODS:

Mutation analysis and carrier detection was done by multiplex PCR and MLPA and the results were compared.

RESULTS AND CONCLUSIONS:

We present data showing utility of MLPA in identifying mutations in cases with DMD/BMD. In the present study using MLPA, we identified mutations in additional 5.6% cases of DMD in whom multiplex PCR was not able to detect intragenic deletions. In addition, MLPA also correctly confirmed carrier status of two obligate carriers and revealed carrier status in 6 of 8 mothers of sporadic cases.     

Nephrotoxicity after radionuclide therapies

Radioligand therapies have opened new treatment avenues for cancer patients. They offer precise tumor targeting with a favorable efficacy-to-toxicity profile. Specifically, the kidneys, once regarded as the critical organ for radiation toxicity, also show excellent tolerance to radiation doses as high as 50–60 Gy in selected cases. However, the number of nephrons that form the structural and functional units of the kidney is determined before birth and is fixed. Thus, loss of nephrons secondary to any injury may lead to an irreversible decline in renal function over time. Our primary understanding of radiation-induced nephropathy is derived from the effects of external beam radiation on the renal tissue. With the growing adoption of radionuclide therapies, considerable evidence has been gained with regard to the occurrence of renal toxicity and its associated risk factors. In this review, we discuss the radionuclide therapies associated with the risk of nephrotoxicity, the present understanding of the factors and mechanisms that contribute to renal injury, and the current and potential methods for preventing, identifying, and managing nephrotoxicity, specifically acute onset nephropathies.     

LSm1-7 complexes bind to specific sites in viral RNA genomes and regulate their translation and replication

LSm1-7 complexes promote cellular mRNA degradation, in addition to translation and replication of positive-strand RNA viruses such as the Brome mosaic virus (BMV). Yet, how LSm1-7 complexes act on their targets remains elusive. Here, we report that reconstituted recombinant LSm1-7 complexes directly bind to two distinct RNA-target sequences in the BMV genome, a tRNA-like structure at the 3′-untranslated region and two internal A-rich single-stranded regions. Importantly, in vivo analysis shows that these sequences regulate the translation and replication of the BMV genome. Furthermore, both RNA-target sequences resemble those found for Hfq, the LSm counterpart in bacteria, suggesting conservation through evolution. Our results provide the first evidence that LSm1-7 complexes interact directly with viral RNA genomes and open new perspectives in the understanding of LSm1-7 functions.     

Saccharification of Complex Cellulosic Substrates by the Cellulase System from Clostridium thermocellum

True cellulase activity has been demonstrated in cell-free preparations from the thermophilic anaerobe Clostridium thermocellum. Such activity depends upon the presence of Ca²⁺ and a thiol-reducing agent of which dithiothreitol is the most promising. Under these conditions, native (cotton) and derived forms of cellulose (Avicel and filter paper) were all extensively solubilized at rates comparable with cellulase from Trichoderma reesei. Maximum activity of the Clostridium cellulase was displayed at 70°C and at pH 5.7 and 6.1 on Avicel and carboxymethylcellulose, respectively. In the absence of substrate at temperatures up to 70°C, carboxymethylcellulase was much more unstable than the Avicel-hydrolyzing activity.     

Apoptosis of airway epithelial cells in response to meconium

Meconium aspiration syndrome (MAS) is common among newborn children but its mechanism is unclear. The syndrome is known to produce a strong inflammatory reaction in the lungs resulting in massive cell death. In this work we studied lung cell death by apoptosis after meconium aspiration in forty two-week-old rabbit pups. Analyzing lung samples by ISEL-DNA end labeling demonstrated the specific spread of apoptotic bodies throughout the lungs. These bodies were shrunken and smaller in size compared to normal cells and many of them were lacking cell membranes. About 70% of all apoptotic bodies were found among the airway epithelium cell eight hours after meconium instillation. In comparison, among lung alveolar cells, only about 20% cells were apoptotic in the same animals. In meconium-treated lungs and A549 cells, a significant increase of angiotensinogen mRNA and Caspase-3 expression were observed. The pretreatment of cells with Caspase-3 inhibitor ZVAD-fmk significantly inhibited meconium-induced lung cell death by apoptosis. These findings demonstrate the apoptotic process in meconium-instilled lungs or A549 cells in culture. Our results show lung airway epithelial and A549 cell apoptosis after meconium instillation. We suggest that studies of lung airway epithelial cell death are essential to understanding the pathophysiology of MAS and may present a key point in future therapeutic applications.     

Chitosan in Surface Modification for Bone Tissue Engineering Applications

Traditional methods of bone defect repair include autografts, allografts, surgical reconstruction, and metal implants that have several disadvantages such as donor site morbidity, rejection, risk of disease transmission, and repetitive surgery. Biomaterial‐based bone reconstructions can, therefore, be an efficient alternative due to the inherent properties of the materials. Chitosan (CS), the deacetylated form of chitin, is a biopolymer having a wide array of applicability in regenerative tissue applications owing to its biocompatible, in vitro degradative and bioresorbable nature. Extensive studies are being carried out using CS to augment the properties of the already existing methods and to also improve the applicability of CS‐based biocomposites in bone tissue repair. In this review, the suitability of CS as a surface modifier has been discussed in detail for the already existing implants, surface modifications of CS‐based natural biocomposites for bone tissue regeneration, and the wide range of techniques that can introduce these modifications. CS, being a natural polymer, possesses advantageous properties including surface modifier that makes it a suitable candidate for bone regeneration, and further research to investigate its osteogenic potential in vivo along with the molecular and signaling mechanisms involved in bone regeneration can aid in expanding its applicability in clinical trials.     

Novel role of phospholipase C-delta1: regulation of liver mitochondrial Ca2+ uptake

Mitochondrial Ca2+ (mCa2+) handling is an important regulator of liver cell function that controls events ranging from cellular respiration and signal transduction to apoptosis. Cytosolic Ca2+ enters mitochondria through the ruthenium red-sensitive mCa2+ uniporter, but the mechanisms governing uniporter activity are unknown. Activation of many Ca2+ channels in the cell membrane requires PLC. This activation commonly occurs through phosphitidylinositol-4,5-biphosphate (PIP2) hydrolysis and the production of the second messengers inositol 1,4,5-trisphosphate [I(1,4,5)P3] and 1,2-diacylglycerol (DAG). PIP2 was recently identified in mitochondria. We hypothesized that PLC exists in liver mitochondria and regulates mCa2+ uptake through the uniporter. Western blot analysis with anti-PLC antibodies demonstrated the presence of PLC-delta1 in pure preparations of mitochondrial membranes isolated from rat liver. In addition, the selective PLC inhibitor U-73122 dose-dependently blocked mCa2+ uptake when whole mitochondria were incubated at 37 degrees C with 45Ca2+. Increasing extra mCa2+ concentration significantly stimulated mCa2+ uptake, and U-73122 inhibited this effect. Spermine, a uniporter agonist, significantly increased mCa2+ uptake, whereas U-73122 dose-dependently blocked this effect. The inactive analog of U-73122, U-73343, did not affect mCa2+ uptake in any experimental condition. Membrane-permeable I(1,4,5)P3 receptor antagonists 2-aminoethoxydiphenylborate and xestospongin C also inhibited mCa2+ uptake. Although extra mitochondrial I(1,4,5)P3 had no effect on mCa2+ uptake, membrane-permeable DAG analogs 1-oleoyl-2-acetyl-sn-glycerol and DAG-lactone, which inhibit PLC activity, dose-dependently inhibited mCa2+ uptake. These data indicate that PLC-delta1 exists in liver mitochondria and is involved in regulating mCa2+ uptake through the uniporter.