N-banding in polytene chromosomes of Chironomus and Drosophila

The N-banding patterns of the polytene chromosomes of Drosophila melanogaster, Chironomus melanotus, Ch. th. thummi and Ch. th. thummi x Ch. th. piger were studied. In Chironomus the polytene N-banding patterns correspond to the polytene puffing patterns. This is revealed by comparison of the puffing and N-banding patterns of identical chromosomes. Size and staining intensity of the N-bands reflect the size of the puffs as shown by puff induction. There is no evidence that the N-bands are also located in Chironomus heterochromatin or are restricted to the nucleolar organizer regions. In Drosophila the -heterochromatin is strongly N-positive, whereas the -heterochromatin, as well as the Chironomus heterochromatin is not N-banded. Contrary to Chironomus, the puffs in Drosophila polytene chromosomes do not give rise selectively to well stained N-bands. — The N-banding method is interpreted to stain specifically non-histone protein which is (1) accumulated in genetically active chromosome regions and (2) present in a specific type of heterochromatin (-heterochromatin of Drosophila).     

A peroxisomal glycolate oxidase in the algaMougeotia

Microbodies of the algaMougeotia were isolated in a linear sucrose gradient. The organelles, which moved to the density 1.24 g cm^–3, contained about 70% of the glycolate oxidase (EC 1.1.3.1) found in this alga. The enzyme oxidized glycolate, utilizing either oxygen or 2,6-dichlorophenolindophenol (DCPIP) as the electron acceptor. L-Lactate was an alternate substrate; almost no D-lactate was utilized. In the presence of O₂, a K_m of 415 M was determined for glycolate, whereas the K_m for L-lactate was about 5,000 M. In the presence of DCPIP, lower concentrations of glycolate and L-lactate were sufficient to obtain the highest rates of enzyme activity.Abbreviations DCPIP 2,6-dichlorophenolindophenol Supported by the Deutsche Forschungsgemeinschaft     

Pelvic visceral arteries of rabbits (Oryctolagus cuniculus)]

40 pelvic preparations of rabbits (oryctolagus cuniculus) were bilaterally studied by dissection under the stereomicroscope and angiography. The arterial pattern of the pelvis, i.e. origin and branching of the umbilical, urogenital and internal pudendal arteries (visceral branches), is described. The main characteristics observed are as follows: (1) The umbilical artery is permeable in adults and gives origin to the cranial vesical artery and a caudal branch that irrigates the pelvic urogenital organs and, eventually, the rectum, with six patterns of branching in both sexes. (2) Usually, the urogenital artery is the continuation of the visceral branch of the internal iliac artery. In 1 animal, unilaterally, it arises from the median sacral artery. In 12 animals (6 bilaterally and 6 unilaterally) the urogenital artery is absent. When present, it forms two branches, a cranial and a caudal one, that irrigate of the urogenital organs in both sexes. (3) The internal pudendal artery is the direct continuation of the internal iliac artery and gives to rise to some visceral branches that irrigate the penis, bulbourethral gland and rectum (with six patterns of branching) in males, and the vagina, clitoris and rectum (with three patterns of branching) in females.     

An automatic method for determination of urinary 3-methylhistidine: normal values.

A system for automatic analysis of urinary 3-methylhistidine is described, applying ion-exchange chromatography and using an automatic sample injector, a motoric selector valve, and a diode programmer, which controls the analytical system. The method permits a sampling rate of 22 samples/day. 3-Methylhistidine was completely separated from histidine in 37 min whereas 1-methylhistidine was eluted together with ammonia. The 3-methylhistidine concentration was linear up to 150 nmol/ml and no appreciable sample interaction was found at automatic sequential runs. The error, in a single determination based on duplicate samples, was 4.61% and, in duplicated determinations, 3.26%. The mean urinary 3-methylhistidine output was 299.4 ± 23.8 μmol/day in 12 healthy females and 545.5 ± 35.2 μmol/day in 12 healthy males. The 3-methylhistidine excretion was significantly higher in males than in females, when expressed as the absolute daily output or as the estimated ratio to body weight, body surface area, or creatinine.     

Studies on polytene chromosomes of Smittia parthenogenetica (Chironomidae,Diptera)

In polytene chromosome II of Smittia parthenogenetica a heterochromatin insertion has been studied which is derived from a germ-line limited chromosome section (Bauer, 1970). This insertion is C-banding positive, late replicating, inactive in RNA synthesis, fluoresces brightly with quinacrine and is polytenized. After N-banding a major part of the heterochromatin insertion is N-banding negative, whereas in the centre of the insertion a N-banding positive body is present. The properties of the N-positive and N-negative parts of the inserted heterochromatin section are compared with the properties of the heterochromatin of Chironomus melanotus and Drosophila melanogaster. It is concluded that the heterochromatin insertion consists of two different heterochromatin types and it is discussed whether the N-banding positive part within the insertion represents a heterochromatin type which is underreplicated during polytenization.Dedicated to Professor Dr. Hans Bauer in honour of his 75th birthday on September 27, 1979     

Sialyl-transferase mitochondriale

A sialyl transferase activity is found in purified mitochondria. It is not due to residual contamination and this enzymatic system is located in the outer mitochondrial membrane. This proves mitochondrial autonomy in regard to glycoconjugate sialylation.     

The ultrastructure of the blood vessels of Branchiostoma lanceolatum (Pallas) (Cephalochordata)

Summary The ultrastructure of the blood vessels in the caudal region of Branchiostoma is described in specimens injected with indian ink. None of the vessels have endothelial cells delimiting the luminal surface. The vessels are delimited either by dense connective tissue or by the characteristic basement lamella underneath the basal lamina of the myocoelic epithelium. It is proposed that the main blood flow in the caudal region follows different pathways depending on the activity of the animal. During swimming the muscle activity of the caudal muscles may have the effect that more blood flows from the aorta to the myoseptal plexi and is drained to the caudal vessel. In the resting animal it is possible that the blood flow through the myosepta is insignificant, and that the caudal blood flow is more or less restricted to the direct connections between the aorta and the caudal vessel: the dorsoventral anastomosis and the segmental connecting vessels.Supported by a grant from the Danish Natural Science Research Council     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.