Visfatin induces sickness responses in the brain

Background/Objective

Visfatin, also known as nicotiamide phosphoribosyltransferase or pre-B cell colony enhancing factor, is a pro-inflammatory cytokine whose serum level is increased in sepsis and cancer as well as in obesity. Here we report a pro-inflammatory role of visfatin in the brain, to mediate sickness responses including anorexia, hyperthermia and hypoactivity.

Methodology

Rats were intracerebroventricularly (ICV) injected with visfatin, and changes in food intake, body weight, body temperature and locomotor activity were monitored. Real-time PCR was applied to determine the expressions of pro-inflammatory cytokines, proopiomelanocortin (POMC) and prostaglandin-synthesizing enzymes in their brain. To determine the roles of cyclooxygenase (COX) and melanocortin in the visfatin action, rats were ICV-injected with visfatin with or without SHU9119, a melanocortin receptor antagonist, or indomethacin, a COX inhibitor, and their sickness behaviors were evaluated.

Principal Findings

Administration of visfatin decreased food intake, body weight and locomotor activity and increased body temperature. Visfatin evoked significant increases in the levels of pro-inflammatory cytokines, prostaglandin-synthesizing enzymes and POMC, an anorexigenic neuropeptide. Indomethacin attenuated the effects of visfatin on hyperthermia and hypoactivity, but not anorexia. Further, SHU9119 blocked visfatin-induced anorexia but did not affect hyperthermia or hypoactivity.

Conclusions

Visfatin induced sickness responses via regulation of COX and the melanocortin pathway in the brain.     

Prognostic Value of Lactate and Central Venous Oxygen Saturation after Early Resuscitation in Sepsis Patients

The objective of this study was to evaluate the prognostic value of static and dynamic variables of central venous oxygen saturation (ScvO₂) and lactate in patients with severe sepsis or septic shock who underwent early quantitative resuscitation. We also investigated whether ScvO₂ measured after initial resuscitation could provide additive prognostic value to that of lactate. We analyzed the sepsis registry for patients presenting to the emergency department and included patients with simultaneous measurements of lactate and ScvO₂ at the time of presentation (H0) and 6 hours (H6) after resuscitation. The primary outcome was 28-day mortality and multivariable logistic analysis was used to adjust for confounders. A total of 363 patients were included, and the overall 28-day mortality was 18%. The area under the receiver operator characteristic curve for predicting 28-day mortality was as follows: lactate (H6), 0.81; lactate (H0), 0.73; relative lactate change, 0.67; ScvO₂ (H6), 0.65; relative ScvO₂ change 0.59; ScvO₂ (H0), 0.58. Patients with lactate normalization showed significantly lower 28-day mortality compared to patients without lactate normalization (3% vs. 28%, P<0.01). However, in those who achieved ScvO₂ (H6) ≥70%, there was a significant difference in 28-mortality only in patients without lactate normalization (21% vs. 39%, P<0.01) but no difference in those with lactate normalization (4% vs. 3%, P = 0.71). In multivariable analysis, lactate normalization was significantly associated with 28-day mortality (adjusted odds ratio [OR] for 28-day mortality, 0.20; 95% confidence interval [CI], 0.07–0.54; P <0.01), but ScvO₂ (H6) ≥70% showed only a marginal association (the adjusted OR for 28-day mortality, 0.51; 95% CI, 0.26–1.01; P = 0.05). ScvO₂ (H6) ≥70% was associated with 28-day mortality only in cases without lactate normalization in subgroup analysis (adjusted OR 0.37, 95% CI, 0.18–0.79; P = 0.01). Six-hour lactate was the strongest predictor of 28-day mortality in patients with severe sepsis or septic shock. Six-hour ScvO₂ provided additional prognostic value only in cases where lactate values were not normalized after resuscitation.     

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K_d [kanamycin] = 78.8 nM, K_d [kanamycin B] = 84.5 nM, and K_d [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.     

The role of disulfide bond isomerase A (DsbA) of Escherichia coli O157:H7 in biofilm formation and virulence

The role of periplasmic disulfide oxidoreductase DsbA in Shiga toxin-producing Escherichia coli O157:H7 (STEC) was investigated. Deletion of dsbA (DeltadsbA) significantly decreased cell motility and alkaline phosphatase activity in STEC. STEC DeltadsbA also showed greater sensitivity to menadione and under low pH conditions. Significant reductions in surface attachment to both biotic (HT-29 epithelial cells) and abiotic (polystyrene and polyvinyl chloride) surfaces were observed in STEC DeltadsbA. In addition, no biofilm formation was detected in STEC DeltadsbA compared to wild-type cells in glass capillary tubes under continuous flow-culture system conditions. In the nematode model Caenorhabditis elegans-killing assay, the deletion of dsbA in STEC resulted in attenuated virulence compared to wild-type cells. STEC DeltadsbA was also found to have a reduced ability to colonize the nematode gut. These results suggest that DsbA plays important roles in biofilm formation and virulence in STEC cells.     

The Arabidopsis small G protein ROP2 is activated by light in guard cells and inhibits light-induced stomatal opening

ROP small G proteins function as molecular switches in diverse signaling processes. Here, we investigated signals that activate ROP2 in guard cells. In guard cells of Vicia faba expressing Arabidopsis thaliana constitutively active (CA) ROP2 fused to red fluorescent protein (RFP-CA-ROP2), fluorescence localized exclusively at the plasma membrane, whereas a dominant negative version of RFP-ROP2 (DN-ROP2) localized in the cytoplasm. In guard cells expressing green fluorescent protein-ROP2, the relative fluorescence intensity at the plasma membrane increased upon illumination, suggesting that light activates ROP2. Unlike previously reported light-activated factors, light-activated ROP2 inhibits rather than accelerates light-induced stomatal opening; stomata bordered by guard cells transformed with CA-rop2 opened less than controls upon light irradiation. When introduced into guard cells together with CA-ROP2, At RhoGDI1, which encodes a guanine nucleotide dissociation inhibitor, inhibited plasma membrane localization of CA-ROP2 and abolished the inhibitory effect of CA-ROP2 on light-induced stomatal opening, supporting the negative effect of active ROP2 on stomatal opening. Mutant rop2 Arabidopsis guard cells showed phenotypes similar to those of transformed V. faba guard cells; CA-rop2 stomata opened more slowly and to a lesser extent, and DN-rop2 stomata opened faster than wild-type stomata in response to light. Moreover, in rop2 knockout plants, stomata opened faster and to a greater extent than wild-type stomata in response to light. Thus, ROP2 is a light-activated negative factor that attenuates the extent of light-induced changes in stomatal aperture. The inhibition of light-induced stomatal opening by light-activated ROP2 suggests the existence of feedback regulatory mechanisms through which stomatal apertures may be finely controlled.     

Hyponatremia Predicts New-Onset Cardiovascular Events in Peritoneal Dialysis Patients

Background and Aim

Cardiovascular (CV) disease is the leading cause of morbidity and mortality in patients on peritoneal dialysis (PD). Hyponatremia was recently shown to be a modifiable factor that is strongly associated with increased mortality in PD patients. However, the clinical impact of hyponatremia on CV outcomes in these patients is unclear.

Methods

To determine whether a low serum sodium level predicts the development of CV disease, we carried out a prospective observational study of 441 incident patients who started PD between January 2000 and December 2005. Time-averaged serum sodium (TA-Na) levels were determined to investigate the ability of hyponatremia to predict newly developed CV events in these patients.

Results

During a mean follow-up of 43.2 months, 106 (24.0%) patients developed new CV events. The cumulative incidence of new-onset CV events after the initiation of PD was significantly higher in patients with TA-Na levels ≤ 138 mEq/L than in those with a TA-Na > 138 mEq/L. After adjustment for multiple potentially confounding covariates, an increase in TA-Na level was found to be associated with a significantly lower risk of CV events (subdistribution hazard ratio per 1 mEq/L increase, 0.90; 95% confidence interval, 0.83–0.96; p = 0.003). Patients with a TA-Na ≤ 138 mEq/L had a 2.31-fold higher risk of suffering a CV event.

Conclusions

These results provide evidence of a clear association between low serum sodium and new-onset CV events after dialysis initiation in PD patients. Whether the correction of hyponatremia for this indication provides additional protection for the development of CV disease in these patients remains to be addressed in interventional studies.     

Genetic differentiation of piscivorous chub (genus Opsariichthys) in Japan,Korea and Russia

A comparison of allozyme variation, restriction fragment length polymorphisms in the mitochondrial DNA and partial sequences of the ND II gene (496 bp) was made among two lacustrine populations of the piscivorous chub (Opsariichthys uncirostris uncirostris) in Japan, four fluvial populations in Korea, one lacustrine population in Russia and one specimen from the Amur River (O. u. amurensis). All analyses indicate that the Japanese populations of piscivorous chub are separable from the Asian mainland populations of Korea and Russia. The latter populations were further divided into the Korean and Russian fish. Although opinions are divided on the phylogenetic position of the population in Lake Mikata, Japan, which shows unique morphological traits intermediate between those of the population in Lake Biwa and the mainland populations, the current analysis indicates a closer relationship to the population in Lake Biwa.     

SOX2 plays a crucial role in cell proliferation and lineage segregation during porcine pre‐implantation embryo development

ObjectivesGene regulation in early embryos has been widely studied for a long time because lineage segregation gives rise to the formation of a pluripotent cell population, known as the inner cell mass (ICM), during pre‐implantation embryo development. The extraordinarily longer pre‐implantation embryo development in pigs leads to the distinct features of the pluripotency network compared with mice and humans. For these reasons, a comparative study using pre‐implantation pig embryos would provide new insights into the mammalian pluripotency network and help to understand differences in the roles and networks of genes in pre‐implantation embryos between species.Materials and methodsTo analyse the functions of SOX2 in lineage segregation and cell proliferation, loss‐ and gain‐of‐function studies were conducted in pig embryos using an overexpression vector and the CRISPR/Cas9 system. Then, we analysed the morphological features and examined the effect on the expression of downstream genes through immunocytochemistry and quantitative real‐time PCR.ResultsOur results showed that among the core pluripotent factors, only SOX2 was specifically expressed in the ICM. In SOX2‐disrupted blastocysts, the expression of the ICM‐related genes, but not OCT4, was suppressed, and the total cell number was also decreased. Likewise, according to real‐time PCR analysis, pluripotency‐related genes, excluding OCT4, and proliferation‐related genes were decreased in SOX2‐targeted blastocysts. In SOX2‐overexpressing embryos, the total blastocyst cell number was greatly increased but the ICM/TE ratio decreased.ConclusionsTaken together, our results demonstrated that SOX2 is essential for ICM formation and cell proliferation in porcine early‐stage embryogenesis.     

Central lactate metabolism suppresses food intake via the hypothalamic AMP kinase/malonyl-CoA signaling pathway

Previous studies showed that centrally administered glucose and fructose exert different effects on food intake - glucose decreasing and fructose increasing food intake. Because of the uncertainty of whether fructose can cross the blood-brain-barrier, the question is raised; can dietary fructose directly enter the CNS? Evidence is presented that fructose administered by intraperitoneal (ip) injection to mice is rapidly (<10 min) converted to lactate in the hypothalamus. Thus, fructose can cross the blood-brain-barrier to enter the CNS/hypothalamus for conversion to lactate without prior (slower) conversion to glucose in the liver. Fructose-derived hypothalamic lactate is not, however, responsible for the orexigenic effect of fructose. Ip lactate administered at a level equivalent to that of fructose generates a higher level of hypothalamic lactate, which rapidly triggers dephosphorylation/inactivation of AMP-kinase. Thereby, ACC — a substrate of AMP-kinase that catalyzes malonyl-CoA formation — is dephosphorylated and activated. Consistent with these findings, ip or centrally (icv) administered lactate rapidly increases (<10 min) hypothalamic malonyl-CoA. Increasing hypothalamic malonyl-CoA suppresses the expression of the orexigenic and increases the expression of the anorexigenic neuropeptides, which decrease food intake. All downstream effects of hypothalamic lactate are blocked by icv administered oxamate, a potent inhibitor of lactate dehydrogenase, thus verifying the central action of lactate.