Glutamatergic Transmission in the Rat Brain and Gravitational Stress

The effects of hypergravity stress on L-[¹⁴C]-glutamate release from synaptosomes obtained from the rat brain and on the kinetic parameters of high-affinity glutamate transport activity were investigated. We found that hypergravity stress affected only the Ca²⁺-dependent component of L-[¹⁴C]-glutamate release. It did not modify the transporter affinity, but the maximum rate of uptake dropped from 12.5 ± 3.2 to 5.6 ± 0.9 nmol/min/mg of protein (in control rats and in animals subjected to hypergravity, respectively).     

Physico-chemical properties of borate derivatives of DOPA, dopamine, and their liposome forms

To increase the solubility of L-3,4-dihydroxyphenylalanine (DOPA) and dopamine (DA) incorporated in liposomes, it was suggested to convert them into ammonium and 1-adamantylammonium borate complexes. The structure of these complexes was studied by 11B and 1H NMR, IR, and mass spectrometry and conductometry. The liposomic form of the complexes is characterized by a high active compound/lipid molar ratio (0.5). Catechols in the form of complex salts are retained better within the inner volume of liposomes.     

New species of actinomycete Streptomyces variegatus sp. nov. synthesizing an antibiotic of the alpha-hydroxyketopentaene group

Stroptomyces strains INA T-511 and INA 3946 were isolated from 2 different soil samples. Both the strains produced an antibiotic of the group of alpha-hydroxyketopentaenes. The antibiotic was active against gram-positive bacteria, yeasts and fungi belonging to Penicillium. In addition, the strains produced a pigment antibiotic of the prodigiosin type and a pigment identified as ferroverdin. The study of the cultural and morphological features and the natural variation of the strains has shown that they belong to a new species, designated as Streptomyces variegatus sp. nov. Sveshnikova et Timuk.     

Mechanism of blockage of amphotericin B channels in a lipid bilayer.

A number of organic compounds (non-electrolytes, tetraalkylammonia, etc.) with a molecular size of 6--8 angstrom decrease the conductance of ionic channels formed in the lipid bilayer by a polyene antibiotic amphotericin B. It is suggested that these compounds, upon entering the channel, block the passage of inorganic ions. The extent of conductance blockage by organic ions depends on the membrane potential and electrolyte concentration. In the presence of ionic blockers, for instance tetraethylammonium, amphotericin B-containing membranes assume some properties characteristic of excitable membranes, i.e. the current-voltage characteristic acquires the negative resistance region, and in response to a potential step activation followed by inactivation of conductance is observed. It is shown that the potential dependence of the blockage is due to interaction inside the channel of the blocker ion with penetrating ions, by a mechanism similar to that described by Armstrong ((1979) Q. Rev. Biophys. 7, 179--210) for blockage of squid axon potassium channels by ammonium derivatives.     

A triple-stranded "clip" from the oligonucleotide 3'-(dA)10-pO(Ch2Ch2O)3p-(dT)10-pO(CH2CH2O)3-p-(dT)10(-5)]

The temperature dependence of the UV- and CD-spectra of the oligonucleotides 3'-d(A)10-L-(T)10-5' [anti(AT)], 3'-d(A)10-L-d(T)10-3' [par(AT)] and 3'-d(A)10-L-(dT)10-L-(dT)10-5' [tripl(ATT)] (L = -PO(CH2CH2O) 3p-) in the phosphate buffer at pH 7 under different concentrations of NaCL and in the presence or absence of 0.01 M MgCl2 was studied. All registered structural changes are the result of intramolecular processes if the concentrations of the oligonucleotides is low (about 2.2.10(-5) M). Par(AT) and anti(AT) exist in the only two forms, transforming into each other: under low temperatures they exist as hairpins with the parallel or antiparallel orientation of chains accordingly which transform into unfolded chains when the temperature increased. In contrast trip(ATT) exists in the three different forms depending on the temperature and ion conditions. They are: the three- stranded clip, the two-stranded hairpin with a single stranded "tail" and completely unfolded chain. For the first time this work presents thermodynamic parameters of the triplex formation from deoxyoligonucleotides depending on NaCl concentration. We have registered the CD spectra to one-, two-, and three-stranded forms. Ethidium bromide binding to three-stranded "clip" was investigated, and it was established that molecules of the dye may intercalate into the "clip" with formation of stable complexes (the constant of association 10(6) M-1). It is maximum three molecules of ethidium bromid which may bound to one molecule of the three-stranded clip. It has been shown that the suggested synthetic model (three oligonucleotide blocks combined by hydroxyalkyl chains) is the most convenient for physico-chemical investigations of triplexes today.     

Structure of d(GT)n repeating sequences with parallel and antiparallel chains]

The ability of oligonucleotides 3'-d(GT)5pO(CH2)5Opd(GT)5-5' (anti[d(GT)]) and 3'-d(GT)5pO(CH2)6Opd(GT)5-3' (par[d(GT)]) to form hairpins and higher associates is studied. Optical methods of thermal denaturation and circular dichroism as well as the fluorescence of ethidium bromide and acridine orange bound to oligonucleotides were used. At room temperatures the formation of hairpin structure with parallel and antiparallel strands is possible. Thermodynamic parameters of par[d(GT)] and anti[d(GT)] are similar and equal to delta H = -15 kcal/mol, delta S = -50 cal/mol. deg. In the temperature range 3-10 degrees C par[d(GT)] and anti[d(GT)] form four-stranded structures with parallel chains, in which layers of four G-residues alternate with unpaired T-residues being bulged out easily. On comparison of occurrence of alternating (GT)n, (GC)n and (G)n sequences in genome it can be stated that (GT)n biological functions could be connected with conformational possibilities of the four-stranded parallel structures with unpaired T-residues.     

Conformational transition of parallel DNA in solutions with decreased water activity]

Conformations of parallel deoxyoligonucleotides 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' and 5'd(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)3'/'5'd (ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)3' were studied in solution by CD method. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2'endo sugar conformation to a A-like form designated as Ap. The free energy difference between Ap- and B-like conformations of the parallel decaduplex is close to that for antiparallel decaduplex with the nucleotide sequence studied. A-phility of a parallel helix is dependent on its sequence.     

Effect of Mg ions and spermine on ATP-dependent Ca2+ transport in myometrial intracellular structures. I. Comparative study of Ca2+ accumulation in mitochondria and sarcoplasmic reticulum

In experiments, which were carried out with the use of a radioactive label (45Ca2+) on the suspension of rat uterus myocytes treated by digitonin solution (0.1 mg/ml), influence of Mg ions and spermine on Mg2+, ATP-dependent Ca2+ transport in mitochondria and sarcoplasmic reticulum was investigated. Ca2+ accumulation in mitochondria (1324 +/- 174 pmol Ca2+/10(6) cells for 1 min - the control) was tested as such which was not sensitive to thapsigargin (100 nM) and was blocked by ruthenium red (10 microM). Oxalate-stimulated Ca2+ accumulation in sarcoplasmic reticulum (136 +/- 17 pmol Ca2+/10(6) cells for 1 min - the control) was tested as such which was not sensitive to ruthenium red and was blocked by thapsigargin. It has been shown, that initial speed and level of energy-dependent Ca2+ accumulation in mitochondria considerably exceeded the values of these parameters for sarcoplasmic reticulum Ca2+-accumulation system. Ca2+ accumulation kinetic in mitochondria was characterized by a steady-state phase (for 5-10 min. of incubation) while accumulation kinetic of this cation in sarcoplasmic reticulum corresponded to zero order reaction. Increase of Mg2+ concentration up to 5 mM led to activation of Ca2+-accumulation systems in mitochondria and sarcoplasmic reticulum (values of activation constants K(Mg) for Mg2+ were 2.8 and 0.6 mM, accordingly). Concentration dependence of spermine action on Ca2+ accumulation in mitochondria was described by a dome-shaped curve with a maximum at 1 mM spermine. In case of sarcoplasmic reticulum Ca2+ pump only the inhibition phase was tested at spermine concentration above 1 mM. However values of inhibition constants for both transporting systems were practically identical--5.2 +/- 0.6 and 5.7 +/- 0.7 mM, accordingly. Hence, Mg ions carry out the important role in regulation of energy-dependent Ca2+ transporting systems both in uterus smooth muscle mitochondria and sarcoplasmic reticulum. Spermine acts first of all on mitochondrial calcium uniporter.