Selective portal vein embolization as introduction in major surgery

In the period between the December 2000 and September 2004, altogether 13 patients underwent preoperative portal vein embolization (PPVE); 9 patients with colorectal metastases and 4 patients with hepatocellular carcinoma. The indirect splenic portography was performed after catheter was introduced into superior mesenteric artery via femoral artery approach. The portal vein was punctured percutaneously transhepatic under fluoroscopy. Following portography, selected portal vein segments were embolized by injecting polyvinil alcohol (PVA) particles until stasis of blood flow was achieved. Proximal parts of branches and the channel in the liver parenchyma were occluded with Gelfoam particles. The increase of the remnant liver parenchyma was measured by magnetic resonance imaging. iTwo patients experienced post-embolization syndrome and another one had subcapsular hematoma. The volume of the liver parenchyma increased minimally for 8% and maximally for 109%. Altogether, 10 patients underwent surgical resection. In two patients, the disease progressed and carcinoma spread to the previously healthy liver lobe and in one there was no hypertrophy and we decided for artery chemoembolization (AC). The results show that PPVE triggers a strong regenerative response resulting in hypertrophy of normal liver parenchyma and expand possibilities of curative surgery for patients who would not otherwise have been candidates for extended resection.     

Testing the phylogenetic position of a parasitic plant (Cuscuta, Convolvulaceae, asteridae): Bayesian inference and the parametric bootstrap on data drawn from three genomes

Previous findings on structural rearrangements in the chloroplast genome of Cuscuta (dodder), the only parasitic genus in the morning-glory family, Convolvulaceae, were attributed to its parasitic life style, but without proper comparison to related nonparasitic members of the family. Before molecular evolutionary questions regarding genome evolution can be answered, the phylogenetic problems within the family need to be resolved. However, the phylogenetic position of parasitic angiosperms and their precise relationship to nonparasitic relatives are difficult to infer. Problems are encountered with both morphological and molecular evidence. Molecular data have been used in numerous studies to elucidate relationships of parasitic taxa, despite accelerated rates of sequence evolution. To address the question of the position of the genus Cuscuta within Convolvulaceae, we generated a new molecular data set consisting of mitochondrial (atpA) and nuclear (RPB2) genes, and analyzed these data together with an existing chloroplast data matrix (rbcL, atpB, trnL-F, and psbE-J), to which an additional chloroplast gene (rpl2) was added. This data set was analyzed with an array of phylogenetic methods, including Bayesian analysis, maximum likelihood, and maximum parsimony. Further exploration of data was done by using methods of phylogeny hypothesis testing. At least two nonparasitic lineages are shown to diverge within the Convolvulaceae before Cuscuta. However, the exact sister group of Cuscuta could not be ascertained, even though many alternatives were rejected with confidence. Caution is therefore warranted when interpreting the causes of molecular evolution in Cuscuta. Detailed comparisons with nonparasitic Convolvulaceae are necessary before firm conclusions can be reached regarding the effects of the parasitic mode of life on patterns of molecular evolution in Cuscuta.     

Possible apoptotic mechanism in epidermal cell acantholysis induced by pemphigus vulgaris autoimmunoglobulins

Through a still unclear mechanism, pemphigus vulgaris autoantibodies (PV-IgG) induce intra-epidermal acantholytic lesions responsible for severe to fatal skin wounding. We present evidence that PV lesions contain apoptotic keratinocytes, and that cell death is induced in the lesional tissue apparently before cell separation. These data suggest that apoptosis could be the cause of the acantholytic phenomenon. We show that PV-IgG and an antibody against Fas receptor (anti-FasR) induce lesions in vitro in a similar way, causing: (1) secretion of soluble FasL; (2) elevated cellular amounts of FasR, FasL (soluble and membranal), Bax and p53 proteins; (3) reduction in levels of cellular Bcl-2; (4) enrichment in caspase 8, and activation of caspases 1 and 3; (5) co-aggregation of FasL and FasR with caspase 8 in membranal death-inducing signaling complex (DISC). Hence, the Fas-mediated death signaling pathway seems to be involved in lesion formation. Moreover, we have shown that in skin organ cultures and in keratinocyte cultures, PV-IgG can induce caspase activation and DNA fragmentation, and caspase inhibitors can prevent the formation of PV-IgG-induced epidermal lesions. Altogether, these results suggest that PV-IgG-induced acantholysis may proceed through the death-signaling pathway. They highlight new perspectives on mechanisms of tissue damage in autoimmune diseases.     

Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.     

Development of cytotrophoblast columns from explanted first-trimester human placental villi: role of fibronectin and integrin alpha5beta1

Human first-trimester floating mesenchymal villi explanted onto gels of collagen I or Matrigel were observed to undergo de novo development of anchoring sites. These consisted of cytotrophoblast columns that formed by proliferation of stem villous cytotrophoblast cells, as revealed by whole-mount and thin-section microscopy and incorporation of bromodeoxyuridine into DNA. Column formation occurred exclusively at the distal tips of the villi. No column formation was observed in tissue explanted onto agarose. On Matrigel, the developing columns penetrated downwards into the matrix, whereas on collagen I, cytotrophoblast sheets spread across the surface of the gel and merged to form a shell. The developing columnar cytotrophoblast up-regulated integrins alpha1beta1 and alpha5beta1 and produced an extracellular matrix containing oncofetal fibronectin, as in vivo. Function-blocking antibodies were used to investigate the role of the integrin-fibronectin interaction in anchoring villus development on collagen I. Antibodies to fibronectin and the integrin subunits alpha5 and beta1, added at 24 h, all changed the pattern of cytotrophoblast outgrowth. Anti-fibronectin caused cell rounding within the cytotrophoblast sheet and increased the population of single cells at its periphery. Anti-integrin alpha5 caused rounding and redistribution of cells within the outgrowth. In the presence of anti-integrin beta1, cell-collagen interactions within the sheet were destabilized, often leading to the appearance of an annulus of aggregated cells at the periphery. These results show that 1) mesenchymal villi retain the potential to form anchoring sites until at least the end of the first trimester, 2) adhesion to a permissive extracellular matrix stimulates cytotrophoblast proliferation and differentiation along the extravillous lineage, 3) integrin alpha5beta1-fibronectin interactions contribute significantly to anchorage of the placenta to uterine extracellular matrix. We suggest that as the developing placenta ramifies, new sites of anchorage form whenever peripheral villi contact decidua. This process is predicted to contribute to the stability of the placental-decidual interface.     

Influence of membrane-cortex linkers on the extrusion of membrane tubes

The cell membrane is an inhomogeneous system composed of phospholipids, sterols, carbohydrates, and proteins that can be directly attached to underlying cytoskeleton. The protein linkers between the membrane and the cytoskeleton are believed to have a profound effect on the mechanical properties of the cell membrane and its ability to reshape. Here, we investigate the role of membrane-cortex linkers on the extrusion of membrane tubes using computer simulations and experiments. In simulations, we find that the force for tube extrusion has a nonlinear dependence on the density of membrane-cortex attachments: at a range of low and intermediate linker densities, the force is not significantly influenced by the presence of the membrane-cortex attachments and resembles that of the bare membrane. For large concentrations of linkers, however, the force substantially increases compared with the bare membrane. In both cases, the linkers provided membrane tubes with increased stability against coalescence. We then pulled tubes from HEK cells using optical tweezers for varying expression levels of the membrane-cortex attachment protein Ezrin. In line with simulations, we observed that overexpression of Ezrin led to an increased extrusion force, while Ezrin depletion had a negligible effect on the force. Our results shed light on the importance of local protein rearrangements for membrane reshaping at nanoscopic scales.     

Cytotoxic activities of Hypericum perforatum L. extracts against 2D and 3D cancer cell models

Cytotechnology - Six extracts were obtained from plant species Hypericum perforatum L., collected at Samsun in Turkey. The aim of this study was to examine the mechanisms of the anticancer activity...     

Design,synthesis and cholinesterase inhibitory properties of new oxazole benzylamine derivatives

Abstract

The enzymes acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) are primary targets in attenuating the symptoms of neurodegenerative diseases. Their inhibition results in elevated concentrations of the neurotransmitter acetylcholine which supports communication among nerve cells. It was previously shown for trans-4/5-arylethenyloxazole compounds to have moderate AChE and BChE inhibitory properties. A preliminary docking study showed that elongating oxazole molecules and adding a new NH group could make them more prone to bind to the active site of both enzymes. Therefore, new trans-amino-4-/5-arylethenyl-oxazoles were designed and synthesised by the Buchwald-Hartwig amination of a previously synthesised trans-chloro-arylethenyloxazole derivative. Additionally, naphthoxazole benzylamine photoproducts were obtained by efficient photochemical electrocyclization reaction. Novel compounds were tested as inhibitors of both AChE and BChE. All of the compounds exhibited binding preference for BChE over AChE, especially for trans-amino-4-/5-arylethenyl-oxazole derivatives which inhibited BChE potently (IC₅₀ in µM range) and AChE poorly (IC₅₀?100?µM). Therefore, due to the selectivity of all of the tested compounds for binding to BChE, these compounds could be applied for further development of cholinesterase selective inhibitors.

• HIGHLIGHTS

• Series of oxazole benzylamines were designed and synthesised

• The tested compounds showed binding selectivity for BChE

• Naphthoxazoles were more potent AChE inhibitors

     

Cyclic enediyne–amino acid chimeras as new aminopeptidase N inhibitors

Enediyne–peptide conjugates were designed with the aim to inhibit aminopeptidase N, a widespread ectoenzyme with a variety of functions, like protein digestion, inactivation of cytokines in the immune system and endogenous opioid peptides in the central nervous system. Enediyne moiety was embedded within the 12-membered ring with hydrophobic amino acid alanine, valine, leucine or phenylalanine used as carriers. Aromatic part of the enediyne bridging unit and the amino acid side chains were considered as pharmacophores for the binding to the aminopeptidase N (APN) active site. Additionally, the fused enediyne–amino acid “heads” were bound through a flexible linker to the l-lysine, an amino group donor. The synthesis included building the aromatic enediyne core at the C-terminal of amino acids and subsequent intramolecular N-alkylation. APN inhibition test revealed that the alanine-based derivative 9a inhibits the APN with IC₅₀ of 34 ± 11 μM. Enediyne–alanine conjugate 12 missing the flexible linker was much less effective in the APN inhibition. These results show that enediyne-fused amino acids have potential as new pharmacophores in the design of APN inhibitors.