Characterization of mammalian heart annexins with special reference to CaBP33 (annexin V)

Porcine heart was observed to express annexins V (CaBP33) and VI in large amounts, and annexins III and IV in much smaller amounts. Annexin V (CaBP33) in porcine heart was examined in detail by immunochemistry. Homogenization and further processing of heart in the presence of EGTA resulted in the recovery of annexin V (CaBP33) in the cytosolic fraction and in an EGTA-resistant, Triton X-100-soluble fraction from cardiac membranes. Including Ca2+ in the homogenization medium resulted in a significant decrease in the annexin V (CaBP33) content of the cytosolic fraction with concomitant increase in the content of this protein in myofibrils, mitochrondria, the sarcoplasmic reticulum and the sarcolemma. The amount of annexin V (CaBP33) in each of these subfractions depended on the free Ca2+ concentration in the homogenizing medium. At the lowest free Ca2+ concentration tested, 0.8 microM, only the sarcolemma appeared to contain bound annexin V (CaBP33). Membrane-bound annexins V (CaBP33) and VI partitioned in two fractions, one EGTA-resistant and Triton X-100-extractable, and one Triton X-100-resistant and EGTA-extractable. Altogether, these data suggest that annexins V and VI are involved in the regulation of membrane-related processes.     

Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures

The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.     

Propranolol, atenolol, and trifluoperazine reduce the spontaneous occurrence of meiotic diploid products in Saccharomyces cerevisiae.

The effect of atenolol, propranolol, trifluoperazine, and caffeine on the occurrence of meiotic diploid and disomic products in Saccharomyces cerevisiae was investigated. We demonstrated that atenolol, propranolol, and trifluoperazine reduce the occurrence of meiotic diploid products and that propranolol also slightly decreases the spontaneous frequency of disomics. On the other hand, caffeine appears to be a powerful inducer of diploid meiotic products, but also shows a lesser effect on disomic induction. Since spontaneous or caffeine-induced diploids arise from a failure of the second meiotic division, it appears that the target of these drugs is at the beginning of the second meiotic division. The only common effect of trifluoperazine and propranolol, mainly investigated in mammals, was an inhibition of calmodulin activity via direct interaction. We tend, therefore, to believe that calmodulin activity must be a crucial point for the second meiotic division to begin. The increased induction of diploids, due to caffeine, may be interpreted as a consequence of an increased cyclic AMP level.     

IMP1/imp1: A Gene Involved in the Nucleo-Mitochondrial Control of Galactose Fermentation in SACCHAROMYCES CEREVISIAE

In some strains of Saccharomyces cerevisiae, the induction of enzymes of the Leloir pathway, galactose fermentation and growth on galactose depend on mitochondrial function; mitochondrial dependence is elicited through the recessive allele imp1 of the nuclear gene IMP1. The genetic element IMP1 is not allelic to any of the known GAL genes; IMP1 strains can grow on and ferment galactose in respiratory-deficient (RD) condition or in the presence of the mitochondrial inhibitors ethidium bromide and erythromycin; whereas, imp1 strains can grow on and ferment galactose only in respiratory-sufficient (RS) condition. The imp1 elicited mitochondrial dependence apparently involves regulation of the synthesis of the galactose catabolizing enzymes and synthesis of the galactose specific permease. IMP1 is not the only genetic determinant that elicits an interaction of the mitochondrion and the expression of the Gal system; the GAL3 gene, whose role in galactose utilization is demonstrated by the long-term adaptation phenotype of gal3 RS mutants, gives rise to a noninducible phenotype in RD condition or in the presence of mitochondrial inhibitors.     

DNA of Akodon (Rodentia,Cricetidae). I. Biophysical characterization

Buoyant density in CsCl, melting temperature, and G + C base content of the DNA from four species of Akodon (Rodentia, Cricetidae) were determined. The buoyant density values of 1.699–1.701 g/cm³ were in accordance with the data reported for other cricetids. No satellite bands were seen in neutral CsCl. The T _m values determined in 1 × SSC ranged from 86.2 to 87.0 C, which corresponds to G + C contents of 41.2–43.2%. There was good agreement in DNA base composition of the four species, although values were slightly higher in A. obscurus, suggesting a certain degree of interspecies variability.This study was supported by grants from Comisión de Investigaciones Científicas de la Provincia de Buenos Aires, Consejo Nacional de Investigaciones Científicas y Técnicas, and Organización de Estados Americanos.     

Physical properties and Tris inhibition of an insect trehalase and a thermodynamic approach to the nature of its active site

The midgut from Rhynchosciara americana larvae display a trehalase (alpha,alpha'-trehalose glucohydrolase, EC 3.2.1.28) which is soluble with a molecular weight of 122 000 and pI 4.6. The optimum pH of the enzyme is 6.0, its apparent Km for trehalose is 0.67 mM and its energy of activation is 16.7 kcal/mol. Sulfhydryl reagents do not inhibit the trehalase. The results suggest the existence of two carboxyl groups in the active site, one of which has a very high (8.3) pK. The increase of the pK values of the essential groups of the free enzyme in the presence of increasing concentrations of dioxane supports the hypothesis that these groups are carboxyls. The purified enzyme hydrolyzes only alpha,alpha'-trehalose and it is competitively inhibited by several compounds.     

The synaptic behaviour of the X and Y chromosomes in the marsupial Monodelphis dimidiata

The pairing behaviour of the X and Y chromosomes of Monodelphis dimidiata was studied with light and electron microscopy. Pairing of the sex chromosomes is delayed with respect to autosome synapsis. Both the X and the minute Y chromosome show an axis attached by its two ends to the nuclear envelope. Synapsis of the sex chromosomes occurs by the joining of the chromatin sheaths that surround the axes and by a small, three-layered structure close to the nuclear envelope. The X and Y chromosomes remain joined to each other during the diffuse stage and diplotene-diakinesis but they do not show a synaptonemal complex. During the diffuse stage a dense plate is formed at the boundary between the X-Y body and the nuclear envelope. During early metaphase a folded sheet is attached to the periphery of the X-Y body. This sheet is formed by a piece of the nuclear envelope carrying the dense plate and it shows transverse fibrils and a central element similar to synaptonemal-complex remains. No evidence of a non-chiasmate segregation mechanism was observed. Polarization of the axial ends of the sex chromosomes is observed after X-Y synapsis. These important departures from the X-Y pairing pattern of eutherian mammals are discussed and assumed to present a special mechanism for holding the minute Y joined to the X chromosome in this marsupial.