Epidemiological studies on jute diseases

Summary Hyphae of M. phaseoli failed to grow on unsterilized natural soil and were completely lysed within 4 days of exposure. Germination of sclerotia in natural soil was inhibited indicating soil fungistasis. Lysis of mycelium and inhibition of germination of sclerotia could be annulled by addition of various organic nutrients and fertilizers to natural soil or by autoclaving the soil. Germination of dormant sclerotia in natural soil was stimulated by root-exudates of host and non-host plants. Population of sclerotia buried in unsterilized natural soil gradually declined and after 15 months only 35 per cent of the initial number could be recovered; more than 80 per cent of these germinated when nutrients were added. Data suggest poor saprophytic ability of M. phaseoli in mycelial form and the involvement of dormant sclerotia in the survival of the organism in soil.     

Synergistic effect of ribose and 2-deoxy-ribose with nutrition and auxin in rooting hypocotyl cuttings of Phaseolus mungo

Exogenously supplied ribose and deoxyribose in a medium containingsucrose+ IAA considerably enhanced the formation of roots onhypocotyl cuttings of Phaseolus mungo with intact apex andleaves.The effect increased with increasing concentration of pentosesugars and was more pronounced with deoxyribose than with ribosesugar. (Received October 25, 1975; )     

Endogenous ocular lipids as potential modulators of intraocular pressure

Elevated intraocular pressure (IOP) is a risk factor in glaucoma, a group of irreversible blinding diseases. Endogenous lipids may be involved in regulation of IOP homeostasis. We present comparative fold analysis of phospholipids and sphingolipids of aqueous humour and trabecular meshwork from human control vs primary open-angle glaucoma and mouse control (normotensive) vs ocular hypertensive state. The fold analysis in control vs disease state was based on ratiometric mass spectrometric data for above classes of lipids. We standardized in vitro assays for rapid characterization of lipids undergoing significant diminishment in disease state. Evaluation of lipids using in vitro assays helped select a finite number of lipids that may potentially expand cellular interstitial space embedded in an artificial matrix or increase fluid flow across a layer of cells. These assays reduced a number of lipids for initial evaluation using a mouse model, DBA/2J with spontaneous IOP elevation. These lipids were then used in other mouse models for confirmation of IOP lowering potential of a few lipids that were found promising in previous assessments. Our results provide selected lipid molecules that can be pursued for further evaluation and studies that may provide insight into their function.     

Bacopasaponins with cytotoxic activity against human breast cancer cells in vitro

Molecular Biology Reports - Globally, breast cancer is a serious concern that exhibits a persistent rise in its incidence and related mortality even after significant advancement in the field of...     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Smokeless Tobacco Extract (STE)-Induced Toxicity in Mammalian Cells is Mediated by the Disruption of Cellular Microtubule Network: A Key Mechanism of Cytotoxicity

Smokeless tobacco usage is a growing public health problem worldwide. The molecular mechanism(s) underlying smokeless tobacco associated tissue damage remain largely unidentified. In the present study we have tried to explore the effects of aqueous extract of smokeless tobacco (STE) on tubulin-microtubule, the major cytoskeleton protein that maintains cells morphology and participates in cell division. Exposure to STE resulted in dose-dependent cytotoxicity in a variety of mammalian transformed cell lines such as human lung epithelial cells A549, human liver epithelial cells HepG2, and mouse squamous epithelial cells HCC7, as well as non-tumorogenic human peripheral blood mononuclear cells PBMC. Cellular morphology of STE-treated cells was altered and the associated disruption of microtubule network indicates that STE targets tubulin-microtubule system in both cell lines. Furthermore it was also observed that STE-treatment resulted in the selective degradation of cellular tubulin, whereas actin remains unaltered. In vitro, polymerization of purified tubulin was inhibited by STE with the IC₅₀ value∼150 µg/ml and this is associated with the loss of reactive cysteine residues of tubulin. Application of thiol-based antioxidant N-acetyl cysteine (NAC) significantly abrogates STE-mediated microtubule damage and associated cytotoxicity in both A549 and HepG2 cells. These results suggest that microtubule damage is one of the key mechanisms of STE-induced cytotoxity in mammalian cells.     

miRNA Biogenesis Enzyme Drosha Is Required for Vascular Smooth Muscle Cell Survival

miRNA biogenesis enzyme Drosha cleaves double-stranded primary miRNA by interacting with double-stranded RNA binding protein DGCR8 and processes primary miRNA into precursor miRNA to participate in the miRNA biogenesis pathway. The role of Drosha in vascular smooth muscle cells (VSMCs) has not been well addressed. We generated Drosha conditional knockout (cKO) mice by crossing VSMC-specific Cre mice, SM22-Cre, with Drosha ^loxp/loxp mice. Disruption of Drosha in VSMCs resulted in embryonic lethality at E14.5 with severe liver hemorrhage in mutant embryos. No obvious developmental delay was observed in Drosha cKO embryos. The vascular structure was absent in the yolk sac of Drosha homozygotes at E14.5. Loss of Drosha reduced VSMC proliferation in vitro and in vivo. The VSMC differentiation marker genes, including αSMA, SM22, and CNN1, and endothelial cell marker CD31 were significantly downregulated in Drosha cKO mice compared to controls. ERK1/2 mitogen-activated protein kinase and the phosphatidylinositol 3-kinase/AKT were attenuated in VSMCs in vitro and in vivo. Disruption of Drosha in VSMCs of mice leads to the dysregulation of miRNA expression. Using bioinformatics approach, the interactions between dysregulated miRNAs and their target genes were analyzed. Our data demonstrated that Drosha is required for VSMC survival by targeting multiple signaling pathways.