Computational Analysis of C-Reactive Protein for Assessment of Molecular Dynamics and Interaction Properties

Serum C-reactive protein (CRP) is used as a marker of inflammation in several diseases including autoimmune disease and cardiovascular disease. CRP, a member of the pentraxin family, is comprised of five identical subunits. CRP has diverse ligand-binding properties which depend upon different structural states of CRP. However, little is known about the molecular dynamics and interaction properties of CRP. In this study, we used SAPS, SCRATCH protein predictor, PDBsum, ConSurf, ProtScale, Drawhca, ASAView, SCide and SRide server and performed comprehensive analyses of molecular dynamics, protein–protein and residue–residue interactions of CRP. We used 1GNH.pdb file for the crystal structure of human CRP which generated two pentamers (ABCDE and FGHIJ). The number of residues involved in residue–residue interactions between A–B, B–C, C–D, D–E, F–G, G–H, H–I, I–J, A–E and F–J subunits were 12, 11, 10, 11, 12, 11, 10, 11, 10 and 10, respectively. Fifteen antiparallel β sheets were involved in β-sheet topology, and five β hairpins were involved in forming the secondary structure. Analysis of hydrophobic segment distribution revealed deviations in surface hydrophobicity at different cavities present in CRP. Approximately 33 % of all residues were involved in the stabilization centers. We show that the bioinformatics tools can provide a rapid method to predict molecular dynamics and interaction properties of CRP. Our prediction of molecular dynamics and interaction properties of CRP combined with the modeling data based on the known 3D structure of CRP is helpful in designing stable forms of CRP mutants for structure–function studies of CRP and may facilitate in silico drug design for therapeutic targeting of CRP.     

A STUDY OF ABANDONED ASH PONDS RECLAIMED THROUGH GREEN COVER DEVELOPMENT

Green capping is one of the popular methods to re-vegetate abandoned ash ponds of coal based thermal power plants thereby lowering the risk of contamination to the surrounding environment. It has innumerable advantages such as prevention of dust emission, checking soil erosion, stabilizing the surface areas of ash, preventing potential ground water contamination, and finally, adding native vegetation cover, which is very vital in the long term. During the early nineties and later, various reclamation projects were carried out on fly ash dumps, but until date, there have not been any initiatives to assess the alterations in physicochemical and biological properties of fly ash resulting from implementation of these reclamation projects. In the present study, three abandoned ash ponds, located in India, that were reclaimed during 1998–2003 are investigated. Marked alterations in nutritional status, microbial population, and microbial activities have been observed in reclaimed ash ponds.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Nitrate signals determine the sensing of nitrogen through differential expression of genes involved in nitrogen uptake and assimilation in finger millet

In order to understand the molecular basis of high nitrogen use efficiency of finger millet, five genes (EcHNRT2, EcLNRT1, EcNADH-NR, EcGS, and EcFd-GOGAT) involved in nitrate uptake and assimilation were isolated using conserved primer approaches. Expression profiles of these five genes along with the previously isolated EcDof1 was studied under increased KNO₃ concentrations (0.15 to 1,500 μM) for 2 h as well as at 1.5 μM for 24 h in the roots and shoots of 25 days old nitrogen deprived two contrasting finger millet genotypes (GE-3885 and GE-1437) differing in grain protein content (13.76 and 6.15 %, respectively). Time kinetics experiment revealed that, all the five genes except EcHNRT2 in the leaves of GE-3885 were induced within 30 min of nitrate exposure indicating that there might be a greater nitrogen deficit in leaves and therefore quick transportation of nitrate signals to the leaves. Exposing the plants to increasing nitrate concentrations for 2 h showed that in roots of GE-3885, NR was strongly induced while GS was repressed; however, the pattern was found to be reversed in leaves of GE-1437 indicating that in GE-3885, most of the nitrate might be reduced in the roots but assimilated in leaves and vice-versa. Furthermore, compared with the low-protein genotype, expression of HNRT2 was strongly induced in both roots and shoots of high-protein genotype at the least nitrate concentration supplied. This further indicates that GE-3885 is a quick sensor of nitrogen compared with the low-protein genotype. Furthermore, expression of EcDof1 was also found to overlap the expression of NR, GS, and GOGAT indicating that Dof1 probably regulates the expression of these genes under different conditions by sensing the nitrogen fluctuations around the root zone.     

Smokeless Tobacco Extract (STE)-Induced Toxicity in Mammalian Cells is Mediated by the Disruption of Cellular Microtubule Network: A Key Mechanism of Cytotoxicity

Smokeless tobacco usage is a growing public health problem worldwide. The molecular mechanism(s) underlying smokeless tobacco associated tissue damage remain largely unidentified. In the present study we have tried to explore the effects of aqueous extract of smokeless tobacco (STE) on tubulin-microtubule, the major cytoskeleton protein that maintains cells morphology and participates in cell division. Exposure to STE resulted in dose-dependent cytotoxicity in a variety of mammalian transformed cell lines such as human lung epithelial cells A549, human liver epithelial cells HepG2, and mouse squamous epithelial cells HCC7, as well as non-tumorogenic human peripheral blood mononuclear cells PBMC. Cellular morphology of STE-treated cells was altered and the associated disruption of microtubule network indicates that STE targets tubulin-microtubule system in both cell lines. Furthermore it was also observed that STE-treatment resulted in the selective degradation of cellular tubulin, whereas actin remains unaltered. In vitro, polymerization of purified tubulin was inhibited by STE with the IC₅₀ value∼150 µg/ml and this is associated with the loss of reactive cysteine residues of tubulin. Application of thiol-based antioxidant N-acetyl cysteine (NAC) significantly abrogates STE-mediated microtubule damage and associated cytotoxicity in both A549 and HepG2 cells. These results suggest that microtubule damage is one of the key mechanisms of STE-induced cytotoxity in mammalian cells.     

Catharanthus roseus mitogen-activated protein kinase 3 confers UV and heat tolerance to Saccharomyces cerevisiae

Catharanthus roseus is an important source of pharmaceutically important Monoterpenoid Indole Alkaloids (MIAs). Accumulation of many of the MIAs is induced in response to abiotic stresses such as wound, ultra violet (UV) irradiations, etc. Recently, we have demonstrated a possible role of CrMPK3, a C. roseus mitogen-activated protein kinase in stress-induced accumulation of a few MIAs. Here, we extend our findings using Saccharomyces cerevisiae to investigate the role of CrMPK3 in giving tolerance to abiotic stresses. Yeast cells transformed with CrMPK3 was found to show enhanced tolerance to UV and heat stress. Comparison of CrMPK3 and SLT2, a MAPK from yeast shows high-sequence identity particularly at conserved domains. Additionally, heat stress is also shown to activate a 43 kDa MAP kinase, possibly CrMPK3 in C. roseus leaves. These findings indicate the role of CrMPK3 in stress-induced MIA accumulation as well as in stress tolerance.     

In vitro selection and field responses of somaclonal variant plants of rice cv PR113 for drought tolerance

Drought is the major environmental stress that limits rice productivity worldwide. In vitro somaclonal variation using different selection agents has been used for crop improvement. Here, rice plants of cv PR113 were selected in vitro on 30, 50 and 70 g L^-1 polyethylene glycol 6,000 (PEG). Callus growth, proliferation, calli volume (first and second culture) and plantlet regeneration (third culture) were found to be decreased upto a certain level to acquire tolerance to PEG-induced drought. From the field data, 30 g L^-1 PEG lines showed higher vegetative growth (plant height, tiller number, leaf number, shoot weight and root growth) as compared with 50 g L^-1 PEG selected somaclone lines under limited irrigation. The yield parameters-panicle length, panicle weight, grains per panicle, 1,000-grain weight, grain yield per plant, harvest index and grain straw ratio were also higher in 30 g L^-1 PEG lines as compared with 50 g L^-1 PEG lines. The results, therefore indicate that 30 g L^-1 PEG selected somaclone lines were more suited than 50 g L^-1 PEG selected somaclone lines under stress as compared with WT. The finding suggests that rice cv PR113 somaclones generated on PEG are found to be drought tolerant under field condition with better yield.     

First evidence of ethylene production by Fusarium mangiferae associated with mango malformation

Malformation is arguably the most crucial disease of mango (Mangifera indica L.) at present. It is receiving great attention not only because of its widespread and destructive nature but also because of its etiology and control is not absolutely understood. Recently, Fusarium mangiferae is found to be associated with mango malformation disease. There are indications that stress ethylene production could be involved in the disease. Here we have shown the first direct evidence of production of ethylene in pure culture of F. mangiferae obtained from mango. The study also revealed that all the isolates dissected from mango acquire morphological features of F. mangiferae showing most similarity to the features of species with accepted standard features. The isolates of F. mangiferae from mango were observed to produce ethylene in significant amounts, ranging from 9.28–13.66 n mol/g dry wt/day. The findings presented here suggest that F. mangiferae could contribute to the malformation of mango by producing ethylene and probably stimulating stress ethylene production in malformed tissue of mango. Ethylene might be produced through 2-oxoglutarate-dependent oxygenase-type ethylene-forming-enzyme (EFE) pathway in Fusarium sp, which needs to be investigated.     

miRNA Biogenesis Enzyme Drosha Is Required for Vascular Smooth Muscle Cell Survival

miRNA biogenesis enzyme Drosha cleaves double-stranded primary miRNA by interacting with double-stranded RNA binding protein DGCR8 and processes primary miRNA into precursor miRNA to participate in the miRNA biogenesis pathway. The role of Drosha in vascular smooth muscle cells (VSMCs) has not been well addressed. We generated Drosha conditional knockout (cKO) mice by crossing VSMC-specific Cre mice, SM22-Cre, with Drosha ^loxp/loxp mice. Disruption of Drosha in VSMCs resulted in embryonic lethality at E14.5 with severe liver hemorrhage in mutant embryos. No obvious developmental delay was observed in Drosha cKO embryos. The vascular structure was absent in the yolk sac of Drosha homozygotes at E14.5. Loss of Drosha reduced VSMC proliferation in vitro and in vivo. The VSMC differentiation marker genes, including αSMA, SM22, and CNN1, and endothelial cell marker CD31 were significantly downregulated in Drosha cKO mice compared to controls. ERK1/2 mitogen-activated protein kinase and the phosphatidylinositol 3-kinase/AKT were attenuated in VSMCs in vitro and in vivo. Disruption of Drosha in VSMCs of mice leads to the dysregulation of miRNA expression. Using bioinformatics approach, the interactions between dysregulated miRNAs and their target genes were analyzed. Our data demonstrated that Drosha is required for VSMC survival by targeting multiple signaling pathways.