Contrasting patterns in trophic niche evolution of polymorphic Arctic charr populations in two subarctic Norwegian lakes

Hydrobiologia - Lipid biomarkers in sediments, which are indicative of biological production, provide important information regarding the environmental conditions in and around lakes, and can be...     

Studies of membranotropic and fusogenic activity of two putative HCV fusion peptides

Over the past decades, membranotropic peptides such as positively charged cell-penetrating peptides (CPPs) or amphipathic antimicrobial peptides (AMPs) have received increasing interest in order to improve therapeutic agent cellular uptake.As far as we are concerned, we were interested in studying HCV fusion peptides as putative anchors. Two peptides, HCV6 and HCV7, were identified and conjugated to a fluorescent tag NBD and tested for their interaction with liposomes as model membranes. DSC and spectrofluorescence analyses demonstrate HCV7 propensity to insert or internalize in vesicles containing anionic lipids DMPG whereas no activity was observed with zwitterionic DMPC. This behavior could be explained by the peptide sequence containing a cationic arginine residue. On the contrary, HCV6 did not exhibit any membranotropic activity but was the only sequence able to induce liposomes' fusion or aggregation monitored by spectrofluorescence and DLS. This two peptides mild activity was related to their inefficient structuration in contact with membrane mimetics, which was demonstrated by CD and NMR experiments.Altogether, our data allowed us to identify two promising membrane-active peptides from E1 and E2 HCV viral proteins, one fusogenic (HCV6) and the other membranotropic (HCV7). The latter was also confirmed by fluorescence microscopy with CHO cells, indicating that HCV7 could cross the plasma membrane via an endocytosis process. Therefore, this study provides new evidences supporting the identification of HCV6 as the HCV fusion peptide as well as insights on a novel membranotropic peptide from the HCV-E2 viral protein.     

Identification and characterization of carbapenem binding sites within the RND-transporter AcrB

Understanding the molecular determinants for recognition, binding and transport of antibiotics by multidrug efflux systems is important for basic research and useful for the design of more effective antimicrobial compounds. Imipenem and meropenem are two carbapenems whose antibacterial activity is known to be poorly and strongly affected by MexAB-OprM, the major efflux pump transporter in Pseudomonas aeruginosa. However, not much is known regarding recognition and transport of these compounds by AcrAB-TolC, which is the MexAB-OprM homologue in Escherichia coli and by definition the paradigm model for structural studies on efflux pumps. Prompted by this motivation, we unveiled the molecular details of the interaction of imipenem and meropenem with the transporter AcrB by combining computer simulations with biophysical experiments. Regarding the interaction with the two main substrate binding regions of AcrB, the so-called access and deep binding pockets, molecular dynamics simulations revealed imipenem to be more mobile than meropenem in the former, while comparable mobilities were observed in the latter. This result is in line with isothermal titration calorimetry, differential scanning experiments, and binding free energy calculations, indicating a higher affinity for meropenem than imipenem at the deep binding pocket, while both sharing similar affinities at the access pocket. Our findings rationalize how different physico-chemical properties of compounds reflect on their interactions with AcrB. As such, they constitute precious information to be exploited for the rational design of antibiotics able to evade efflux pumps.     

Extensive Unexplored Human Microbiome Diversity Revealed by Over 150,000 Genomes from Metagenomes Spanning Age,Geography, and Lifestyle

1. Download high-res image (282KB)
2. Download full-size image

     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

AMPA receptor expression in mouse testis and spermatogonial GC-1 cells: A study on its regulation by excitatory amino acids

Excitatory amino acids (EAAs) are found present in the nervous and reproductive systems of animals. Numerous studies have demonstrated a regulatory role for Glutamate (Glu), d -aspartate ( d -Asp) and N-methyl- d -aspartate (NMDA) in the control of spermatogenesis. EAAs are able to stimulate the Glutamate receptors, including the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR). Here in, we assess expression of the main AMPAR subunits, GluA1 and GluA2/3, in the mouse testis and in spermatogonial GC-1 cells. The results showed that both GluA1 and GluA2/3 were localized in mouse testis prevalently in spermatogonia. The subunit GluA2/3 was more highly expressed compared with GluA1 in both the testis and the GC-1 cells. Subsequently, GC-1 cells were incubated with medium containing l -Glu, d -Glu, d -Asp or NMDA to determine GluA1 and GluA2/3 expressions. At 30 minutes and 2 hours of incubation, EAA-treated GC-1 cells showed significantly higher expression levels of both GluA1 and GluA2/3. Furthermore, p-extracellular signal-regulated kinase (ERK), p-Akt, proliferating cell nuclear antigen (PCNA), and Aurora B expressions were assayed in l -Glu-, d -Glu-, and NMDA-treated GC-1 cells. At 30 minutes and 2 hours of incubation, treated GC-1 cells showed significantly higher expression levels of p-ERK and p-Akt. A consequent increase of PCNA and Aurora B expressions was induced by l -Glu and NMDA, but not by d -Glu. Our study demonstrates a direct effect of the EAAs on spermatogonial activity. In addition, the increased protein expression levels of GluA1 and GluA2/3 in EAA-treated GC-1 cells suggest that EAAs could activate ERK and Akt pathways through the AMPAR. Finally, the increased PCNA and Aurora B levels may imply an enhanced proliferative activity.     

Stereotactic radiotherapy for brain oligometastases

Brain metastases, the most common metastases in adults, will develop in up to 40% of cancer patients, accounting for more than one-half of all intracranial tumors. They are most associated with breast and lung cancer, melanoma and, less frequently, colorectal and kidney carcinoma.Magnetic resonance imaging (MRI) is the gold standard for diagnosis. For the treatment plan, computed tomography (CT ) images are co-registered and fused with a gadolinium-enhanced T1-weighted MRI where tumor volume and organs at risk are contoured. Alternatively, plain and contrast-enhanced CT scans are co-registered. Single-fraction stereotactic radiotherapy (SRT ) is used to treat patients with good performance status and up to 4 lesions with a diameter of 30 mm or less that are distant from crucial brain function areas. Fractionated SRT (2–5 fractions) is used for larger lesions, in eloquent areas or in proximity to crucial or surgically inaccessible areas and to reduce treatment-related neurotoxicity. The single-fraction SRT dose, which depends on tumor diameter, impacts local control. Fractionated SRT may encompass different schedules. No randomized trial data compared the safety and efficacy of single and multiple fractions. Both single-fraction and fractionated SRT provide satisfactory local control rates, tolerance, a low risk of transient acute adverse events and of radiation necrosis the incidence of which correlated with the irradiated brain volume.     

Hyperinflammation after anti-SARS-CoV-2 mRNA/DNA vaccines successfully treated with anakinra: Case series and literature review

The current SARS-CoV-2 pandemic diffused worldwide has encouraged the rapid development of vaccines to counter the spread of the virus. At present in Italy, 75.01% of the population completed the vaccination course (AIFA.gov.it) and very few adverse events have been recorded by now. Side-effects related to a theoretical over-reaction of the immune system in response to vaccines administration have been described, and the possibility that an autoimmune or a hyperinflammatory condition may occur was recently observed. Herein, we report four cases of hyperinflammatory syndrome with features indicative of Adult-onset Still’s disease (AOSD) and macrophage activation syndrome (MAS), occurred after anti-SARS-CoV-2 vaccine injection and seen at our Unit between March and May 2021. Since interleukin (IL)-1 is one of the pivotal cytokines involved in AOSD pathogenesis, the inhibition of IL-1 is crucial in ameliorating the clinical symptoms of those patients. Moreover, it has been highlighted the central role of IL-1 as a hallmark of the hyperinflammatory status elicited by SARS-CoV-2 infection. In this case series, we successfully employed the IL-1 receptor antagonist anakinra to curb the cytokine release likely unleashed by the vaccine stimulation in potentially predisposed subjects. We also made a literature search to detect other patients with hyperinflammation temporally related to vaccines injection who benefited from IL-1 inhibition, while other AOSD/MAS-like described syndromes improved with other immunomodulatory strategies.     

Heterogeneous expression of ACE2 and TMPRRS2 in mesenchymal stromal cells

The outbreak of COVID‐19 has become a serious public health emergency. The virus targets cells by binding the ACE2 receptor. After infection, the virus triggers in some humans an immune storm containing the release of proinflammatory cytokines and chemokines followed by multiple organ failure. Several vaccines are enrolled, but an effective treatment is still missing. Mesenchymal stem cells (MSCs) have shown to secrete immunomodulatory factors that suppress this cytokine storm. Therefore, MSCs have been suggested as a potential treatment option for COVID‐19. We report here that the ACE2 expression is minimal or nonexistent in MSC derived from three different human tissue sources (adipose tissue, umbilical cord Wharton`s jelly and bone marrow). In contrast, TMPRSS2 that is implicated in SARS‐CoV‐2 entry has been detected in all MSC samples. These results are of particular importance for future MSC‐based cell therapies to treat severe cases after COVID‐19 infection.     

Spatiotemporal cytokinin response imaging and ISOPENTENYLTRANSFERASE 3 function in Medicago nodule development

Most legumes can establish a symbiotic association with soil rhizobia that trigger the development of root nodules. These nodules host the rhizobia and allow them to fix nitrogen efficiently. The perception of bacterial lipo-chitooligosaccharides (LCOs) in the epidermis initiates a signaling cascade that allows rhizobial intracellular infection in the root and de-differentiation and activation of cell division that gives rise to the nodule. Thus, nodule organogenesis and rhizobial infection need to be coupled in space and time for successful nodulation. The plant hormone cytokinin (CK) contributes to the coordination of this process, acting as an essential positive regulator of nodule organogenesis. However, the temporal regulation of tissue-specific CK signaling and biosynthesis in response to LCOs or Sinorhizobium meliloti inoculation in Medicago truncatula remains poorly understood. In this study, using a fluorescence-based CK sensor (pTCSn::nls:tGFP), we performed a high-resolution tissue-specific temporal characterization of the sequential activation of CK response during root infection and nodule development in M. truncatula after inoculation with S. meliloti. Loss-of-function mutants of the CK-biosynthetic gene ISOPENTENYLTRANSFERASE 3 (IPT3) showed impairment of nodulation, suggesting that IPT3 is required for nodule development in M. truncatula. Simultaneous live imaging of pIPT3::nls:tdTOMATO and the CK sensor showed that IPT3 induction in the pericycle at the base of nodule primordium contributes to CK biosynthesis, which in turn promotes expression of positive regulators of nodule organogenesis in M. truncatula.

Precise spatial and temporal characterization of cytokinin (CK) responses reveals the function of the CK biosynthesis gene ISOPENTENYLTRANSFERASE 3 during nodule development in Medicago truncatula.