Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support.

Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.     

Fertile progeny of a hybridization between soybean [Glycine max (L.) Merr.] and G. tomentella Hayata

Summary A colchicine-doubled F₁ hybrid (2n=118) of a cross between PI 360841 (Glycine max) (2n=40) x PI 378708 (G. tomentella) (2n=78), propagated by shoot cuttings since January 1984, produced approximately 100 F₂ seed during October 1988. One-fourth of the F₂ plants or their F₃ progeny have been analyzed for chromosome number, pollen viability, pubescence tip morphology, seed coat color, and isoenzyme variation. Without exception, all plants evaluated possessed the chromosome number of the G. max parent (2n=40). Most F₂ plants demonstrated a high level of fertility, although 2 of 24 plants had low pollen viability and had large numbers of fleshy pods. One F₂ plant possessed sharp pubescence tip morphology, whereas all others were blunt-tipped. All evaluated F₂ and F₃ plants expressed the malate dehydrogenase and diaphorase isoenzyme patterns of the G. max parent and the endopeptidase isoenzyme pattern of the G. tomentella parent. Mobility variants were observed among progeny for the isoenzymes phosphoglucomutase, aconitase, and phosphoglucoisomerase. This study suggests that the G. Tomentella chromosome complement has been eliminated after genetic exchange and/or modification has taken place between the genomes.Journal Paper No. J-13776 of the Iowa Agriculture and Home Economics Experiment Station, Ames, IA, USA, Project 2763     

Hair cell regeneration

The mammalian inner ear largely lacks the capacity to regenerate hair cells, the sensory cells required for hearing and balance. Recent studies in both lower vertebrates and mammals have uncovered genes and pathways important in hair cell development and have suggested ways that the sensory epithelia could be manipulated to achieve hair cell regeneration. These approaches include the use of inner ear stem cells, transdifferentiation of nonsensory cells, and induction of a proliferative response in the cells that can become hair cells.     

Effects of high-intensity training on muscle lactate transporters and postexercise recovery of muscle lactate and hydrogen ions in women

The purpose of this study was to investigate the effects of high-intensity interval training (3 days/wk for 5 wk), provoking large changes in muscle lactate and pH, on changes in intracellular buffer capacity (betam(in vitro)), monocarboxylate transporters (MCTs), and the decrease in muscle lactate and hydrogen ions (H+) after exercise in women. Before and after training, biopsies of the vastus lateralis were obtained at rest and immediately after and 60 s after 45 s of exercise at 190% of maximal O2 uptake. Muscle samples were analyzed for ATP, phosphocreatine (PCr), lactate, and H+; MCT1 and MCT4 relative abundance and betam(in vitro) were also determined in resting muscle only. Training provoked a large decrease in postexercise muscle pH (pH 6.81). After training, there was a significant decrease in betam(in vitro) (-11%) and no significant change in relative abundance of MCT1 (96 +/- 12%) or MCT4 (120 +/- 21%). During the 60-s recovery after exercise, training was associated with no change in the decrease in muscle lactate, a significantly smaller decrease in muscle H+, and increased PCr resynthesis. These results suggest that increases in betam(in vitro) and MCT relative abundance are not linked to the degree of muscle lactate and H+ accumulation during training. Furthermore, training that is very intense may actually lead to decreases in betam(in vitro). The smaller postexercise decrease in muscle H+ after training is a further novel finding and suggests that training that results in a decrease in H+ accumulation and an increase in PCr resynthesis can actually reduce the decrease in muscle H+ during the recovery from supramaximal exercise.     

Phylogenetic diversity and molecular detection of bacteria in gull feces

In spite of increasing public health concerns about the potential risks associated with swimming in waters contaminated with waterfowl feces, little is known about the composition of the gut microbial community of aquatic birds. To address this, a gull 16S rRNA gene clone library was developed and analyzed to determine the identities of fecal bacteria. Analysis of 282 16S rRNA gene clones demonstrated that the gull gut bacterial community is mostly composed of populations closely related to Bacilli (37%), Clostridia (17%), Gammaproteobacteria (11%), and Bacteriodetes (1%). Interestingly, a considerable number of sequences (i.e., 26%) were closely related to Catellicoccus marimammalium, a gram-positive, catalase-negative bacterium. To determine the occurrence of C. marimammalium in waterfowl, species-specific 16S rRNA gene PCR and real-time assays were developed and used to test fecal DNA extracts from different bird (n = 13) and mammal (n = 26) species. The results showed that both assays were specific to gull fecal DNA and that C. marimammalium was present in gull fecal samples collected from the five locations in North America (California, Georgia, Ohio, Wisconsin, and Toronto, Canada) tested. Additionally, 48 DNA extracts from waters collected from six sites in southern California, Great Lakes in Michigan, Lake Erie in Ohio, and Lake Ontario in Canada presumed to be impacted with gull feces were positive by the C. marimammalium assay. Due to the widespread presence of this species in gulls and environmental waters contaminated with gull feces, targeting this bacterial species might be useful for detecting gull fecal contamination in waterfowl-impacted waters.     

Development of diagnostic test methods for detecting key wildlife pathogens in bacteria-containing commercial biodegradation products

Summary Bacteria-containing commercial products, sold to facilitate biodegradation of human and animal wastes, consist of complex mixtures of bacteria. These mixtures are often of undetermined composition and grown in batch cultures from diverse bacteria-rich inocula of proprietary origins. In order to provide a means of testing for the presence of small numbers of microorganisms, pathogenic to terrestrial or avian wildlife, in bacteria-containing biodegradation products, five DNA extraction protocols were tested for their ability to purify total genomic DNA from nine biodegradation products of different formulations. A diatomaceous earth and guanidine thiocyanate-based DNA extraction method was found to be the most reliable. Fourteen microorganism-specific polymerase chain reaction (PCR)-based assays were developed. Each PCR assay was demonstrated to be specific using DNA from 61 other species of microorganisms (105 different isolates). The mean detection limit for 10 assays using cultured organisms spiked into biodegradation products was assessed. The mean was 1 × 102.62 ± 1 × 10^1.58 c.f.u.g⁻¹ (bacteria) and 1 × 10^3.88 ± 1 × 10^1.14 cells g⁻¹ (protozoa). There were no target wildlife pathogens detected by the 14 PCR assays in unspiked biodegradation products. This study has demonstrated that molecular diagnostic means can be used to detect small numbers of selected wildlife pathogens in complex biodegradation products.     

'Changing climate, changing health, changing stories' profile: using an EcoHealth approach to explore impacts of climate change on inuit health

Global climate change and its impact on public health exemplify the challenge of managing complexity and uncertainty in health research. The Canadian North is currently experiencing dramatic shifts in climate, resulting in environmental changes which impact Inuit livelihoods, cultural practices, and health. For researchers investigating potential climate change impacts on Inuit health, it has become clear that comprehensive and meaningful research outcomes depend on taking a systemic and transdisciplinary approach that engages local citizens in project design, data collection, and analysis. While it is increasingly recognised that using approaches that embrace complexity is a necessity in public health, mobilizing such approaches from theory into practice can be challenging. In 2009, the Rigolet Inuit Community Government in Rigolet, Nunatsiavut, Canada partnered with a transdisciplinary team of researchers, health practitioners, and community storytelling facilitators to create the Changing Climate, Changing Health, Changing Stories project, aimed at developing a multi-media participatory, community-run methodological strategy to gather locally appropriate and meaningful data to explore climate-health relationships. The goal of this profile paper is to describe how an EcoHealth approach guided by principles of transdisciplinarity, community participation, and social equity was used to plan and implement this climate-health research project. An overview of the project, including project development, research methods, project outcomes to date, and challenges encountered, is presented. Though introduced in this one case study, the processes, methods, and lessons learned are broadly applicable to researchers and communities interested in implementing EcoHealth approaches in community-based research.     

Setting an optimal α that minimizes errors in null hypothesis significance tests

Null hypothesis significance testing has been under attack in recent years, partly owing to the arbitrary nature of setting α (the decision-making threshold and probability of Type I error) at a constant value, usually 0.05. If the goal of null hypothesis testing is to present conclusions in which we have the highest possible confidence, then the only logical decision-making threshold is the value that minimizes the probability (or occasionally, cost) of making errors. Setting α to minimize the combination of Type I and Type II error at a critical effect size can easily be accomplished for traditional statistical tests by calculating the α associated with the minimum average of α and β at the critical effect size. This technique also has the flexibility to incorporate prior probabilities of null and alternate hypotheses and/or relative costs of Type I and Type II errors, if known. Using an optimal α results in stronger scientific inferences because it estimates and minimizes both Type I errors and relevant Type II errors for a test. It also results in greater transparency concerning assumptions about relevant effect size(s) and the relative costs of Type I and II errors. By contrast, the use of α = 0.05 results in arbitrary decisions about what effect sizes will likely be considered significant, if real, and results in arbitrary amounts of Type II error for meaningful potential effect sizes. We cannot identify a rationale for continuing to arbitrarily use α = 0.05 for null hypothesis significance tests in any field, when it is possible to determine an optimal α.     

Effects of release method on the survival,somatic growth,and body condition of headstarted turtles

Headstarting involves ex situ rearing of vulnerable life stages, then releasing individuals into the wild once they are larger and less vulnerable to predation. Sometimes, headstarted animals display underdeveloped behaviors that may lead to an acclimation period of reduced survival and growth after release. Using data from a 6-year headstarting program, we tested whether the early release condition affected survival, body condition, and somatic growth rate in 2 groups of headstarted Blanding's turtles (Emydoidea blandingii) released into Rouge National Urban Park (RNUP) in Toronto, Ontario, Canada. The first group included turtles released directly into the wild (i.e., hard release). The second group included turtles released into an in situ enclosure in which individuals remained for a week without food supplementation before being fully released into the wild (i.e., delayed release). Release condition did not affect survival or growth rate. In the delayed-release group, body condition initially declined rapidly and remained low for up to 1 year after release. Given the lack of wild juveniles in RNUP, we compared body condition of headstarted turtles at various time points since release to similar-sized wild juveniles from 2 other Ontario populations, one from Algonquin Provincial Park (APP) and one near Lake Erie (LE). Body condition of headstarted turtles was similar to those of wild APP turtles regardless of release method, and higher than those of wild LE turtles. Our results indicate that delayed release did not improve post-release outcomes for headstarted turtles in an urban landscape and headstarted turtles sustain similar health metrics as wild turtles.