Aspirin inhibits cancer stem cells properties and growth of glioblastoma multiforme through Rb1 pathway modulation

Several clinical studies indicated that the daily use of aspirin or acetylsalicylic acid reduces the cancer risk via cyclooxygenases (Cox-1 and Cox-2) inhibition. In addition, aspirin-induced Cox-dependent and -independent antitumor effects have also been described. Here we report, for the first time, that aspirin treatment of human glioblastoma cancer (GBM) stem cells, a small population responsible for tumor progression and recurrence, is associated with reduced cell proliferation and motility. Aspirin did not interfere with cell viability but induced cell-cycle arrest. Exogenous prostaglandin E₂ significantly increased cell proliferation but did not abrogate the aspirin-mediated growth inhibition, suggesting a Cox-independent mechanism. These effects appear to be mediated by the increase of p21 ^waf1 and p27 ^Kip1, associated with a reduction of Cyclin D1 and Rb1 protein phosphorylation, and involve the downregulation of key molecules responsible for tumor development, that is, Notch1, Sox2, Stat3, and Survivin. Our results support a possible role of aspirin as adjunctive therapy in the clinical management of GBM patients.     

Two case reports of unusual phimosis in rhesus monkeys (Macaca Mulatta)

Phimosis is the inability of the penis to protrude from the prepuce. In the present report, we present two cases of phimosis in two rhesus monkeys. Surgical enlargement of preputial orifice was performed for unrestricted movement of penis. The exact cause of this condition is unknown to us.     

Performance evaluation measures for protein complex prediction

Protein complexes play a dominant role in cellular organization and function. Prediction of protein complexes from the network of physical interactions between proteins (PPI networks) has thus become one of the important research areas. Recently, many computational approaches have been developed to identify these complexes. Various performance assessment measures have been proposed for evaluating the efficiency of these methods. However, there are many inconsistencies in the definitions and usage of the measures across the literature. To address this issue, we have gathered and presented the most important performance evaluation measures and developed a tool, named CompEvaluator, to critically assess the protein complex prediction methods. The tool and documentation are publicly available at https://sourceforge.net/projects/compevaluator/files/.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Exploratory algorithm to devise multi-epitope subunit vaccine by investigating Leishmania donovani membrane proteins

Visceral leishmaniasis (VL) is a deadly parasitic infection which affects poorest to poor population living in the endemic countries. Increasing resistant to existing drugs, disease burden and a significant number of deaths, necessitates the need for an effective vaccine to prevent the VL infection. This study employed a combinatorial approach to develop a multi-epitope subunit vaccine by exploiting Leishmania donovani membrane proteins. Cytotoxic T- and helper T-lymphocyte binding epitopes along with suitable adjuvant and linkers were joined together in a sequential manner to design the subunit vaccine. The occurrence of B-cell and IFN-γ inducing epitopes approves the ability of subunit vaccine to develop humoral and cell-mediated immune response. Physiochemical parameters of vaccine protein were also assessed followed by homology modeling, model refinement and validation. Moreover, disulfide engineering was performed for the increasing stability of the designed vaccine and molecular dynamics simulation was performed for the comparative stability purposes and to conform the geometric conformations. Further, molecular docking and molecular dynamics simulation study of a mutated and non-mutated subunit vaccine against TLR-4 immune receptor were performed and respective complex stability was determined. In silico cloning ensures the expression of designed vaccine in pET28a(+) expression vector. This study offers a cost-effective and time-saving way to design a novel immunogenic vaccine that could be used to prevent VL infection.

Communicated by Ramaswamy H. Sarma     

Upper Cenomanian bivalves from the Guir Basin (southwestern Algeria): Order Veneroida

The Upper Cretaceous rocks are widely distributed and well exposed in south Algeria and consist in beds rich in macrofauna. For the first time, twenty veneroid species (Bivalvia) are systematically described from the upper Cenomanian deposits of the Guir Basin. While three species were reported since long before [Granocardium desvauxi (Coquand), G. productum (J. de C. Sowerby) and Glossus aquilinus (Coquand)]; Lucina fallax Forbes, Crassatella (Rochella) tenuicostata (Seguenza), Protocardia hillana (J. Sowerby), G. productum (J. de C. Sowerby) var. byzacenica (Pervinquière), Arctica cordata (Sharpe), A. humei (Cox), A. inornata (d’Orbigny), A. picteti (Coquand), Tenea delettrei (Coquand), Paraesa faba (J. de C. Sowerby), Meretrix desvauxi (Coquand) were previously unknown from the Cretaceous of Algerian Sahara. Because of reduced degree of preservation, Sphaera cf. corrugata J. Sowerby, Maghrebella cf. forgemoli (Coquand), Maghrebella sp., Granocardium cf. carolinum (d’Orbigny), Protocardia sp. and Meretrix sp. are tentatively determined. The studied material, found in the lower part of the “Calcaires de Sidi Mohamed Ben Bouziane” Formation, evidences palaeobiogeographic affinities occurring over a wide geographical area: from North Africa, southern Europe to Middle East and India. The present study provides new information to the knowledge of the upper Cenomanian palaeobiology of the studied region.     

The potential of novel African isolates of Phthorimaea operculella granulovirus for the control of Tuta absoluta

Phthorimaea operculella granulovirus (PhopGV) is infectious for larvae of different Gelechiidae insect species, including Tuta absoluta and Phthorimaea operculella. As these are major economic pests in North and sub‐Saharan Africa as well as in the Mediterranean area, the development of locally suitable biocontrol agents is essential. We have studied five isolates of PhopGV from Tunisia (Tns16, Tu1.11 and Tu2.11), Kenya (Ken13) and Yemen (Ym14) for their biological activity and the sequence polymorphism of their granulin and ecdysteroid UDP‐glucosyltransferase (egt) genes and allocated the isolates to two different egt types. Infection experiments with neonate larvae of T. absoluta and P. operculella demonstrated their pathogenicity to both host species. The isolate PhopGV Tu1.11 was the most virulent one for T. absoluta but had a relatively low infectivity to two P. operculella populations originating from Italy and Tunisia.     

Biochemical characterization of the Staphylococcus aureus PcrA helicase and its role in plasmid rolling circle replication

Previous genetic studies have suggested that a putative chromosome-encoded helicase, PcrA, is required for the rolling circle replication of plasmid pT181 in Staphylococcus aureus. We have overexpressed and purified the staphylococcal PcrA protein and studied its biochemical properties in vitro. Purified PcrA helicase supported the in vitro replication of plasmid pT181. It had ATPase activity that was stimulated in the presence of single-stranded DNA. Unlike many replicative helicases, PcrA was highly active as a 5' --> 3' helicase and had a weaker 3' --> 5' helicase activity. The RepC initiator protein encoded by pT181 nicks at the origin of replication and becomes covalently attached to the 5' end of the DNA. The 3' OH end at the nick then serves as a primer for displacement synthesis. PcrA helicase showed an origin-specific unwinding activity with supercoiled plasmid pT181 DNA that had been nicked at the origin by RepC. We also provide direct evidence for a protein-protein interaction between PcrA and RepC proteins. Our results are consistent with a model in which the PcrA helicase is targeted to the pT181 origin through a protein-protein interaction with RepC and facilitates the movement of the replisome by initiating unwinding from the RepC-generated nick.