Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Upper Cenomanian bivalves from the Guir Basin (southwestern Algeria): Order Veneroida

The Upper Cretaceous rocks are widely distributed and well exposed in south Algeria and consist in beds rich in macrofauna. For the first time, twenty veneroid species (Bivalvia) are systematically described from the upper Cenomanian deposits of the Guir Basin. While three species were reported since long before [Granocardium desvauxi (Coquand), G. productum (J. de C. Sowerby) and Glossus aquilinus (Coquand)]; Lucina fallax Forbes, Crassatella (Rochella) tenuicostata (Seguenza), Protocardia hillana (J. Sowerby), G. productum (J. de C. Sowerby) var. byzacenica (Pervinquière), Arctica cordata (Sharpe), A. humei (Cox), A. inornata (d’Orbigny), A. picteti (Coquand), Tenea delettrei (Coquand), Paraesa faba (J. de C. Sowerby), Meretrix desvauxi (Coquand) were previously unknown from the Cretaceous of Algerian Sahara. Because of reduced degree of preservation, Sphaera cf. corrugata J. Sowerby, Maghrebella cf. forgemoli (Coquand), Maghrebella sp., Granocardium cf. carolinum (d’Orbigny), Protocardia sp. and Meretrix sp. are tentatively determined. The studied material, found in the lower part of the “Calcaires de Sidi Mohamed Ben Bouziane” Formation, evidences palaeobiogeographic affinities occurring over a wide geographical area: from North Africa, southern Europe to Middle East and India. The present study provides new information to the knowledge of the upper Cenomanian palaeobiology of the studied region.     

The potential of novel African isolates of Phthorimaea operculella granulovirus for the control of Tuta absoluta

Phthorimaea operculella granulovirus (PhopGV) is infectious for larvae of different Gelechiidae insect species, including Tuta absoluta and Phthorimaea operculella. As these are major economic pests in North and sub‐Saharan Africa as well as in the Mediterranean area, the development of locally suitable biocontrol agents is essential. We have studied five isolates of PhopGV from Tunisia (Tns16, Tu1.11 and Tu2.11), Kenya (Ken13) and Yemen (Ym14) for their biological activity and the sequence polymorphism of their granulin and ecdysteroid UDP‐glucosyltransferase (egt) genes and allocated the isolates to two different egt types. Infection experiments with neonate larvae of T. absoluta and P. operculella demonstrated their pathogenicity to both host species. The isolate PhopGV Tu1.11 was the most virulent one for T. absoluta but had a relatively low infectivity to two P. operculella populations originating from Italy and Tunisia.     

A short note on predicted motifs in the Thaparocleidus wallagonius genome

Thaparocleidus wallagonius is a monogenean parasite and a fish-borne pathogen with a worldwide distribution. The genome for Thaparocleidus wallagonius is known. Therefore, it is of interest to report the DNA motif analysis data in the 18S rDNA of Thaparocleidus wallagonius collected from the fish Wallago attu in India. This data forms a framework for an in-depth analysis of the parasite biology and development, immune evasion strategies, virulence and long-term survival within the definitive host.     

Allelopathic effects of Lantana camara Linn. on spore germination of Asterella angusta Steph.--a liverwort

Extract from root, stem and leaf of L. camara proved inhibitory for germination of the spores of A. angusta. Leaf extract was found to exhibit maximum allelopathic potentiality followed by stem and root extract and may be interpreted to be the result of phytotoxic substances which are possibly synthesized in the leaf and translocated to other organs.     

High level production and one-step purification of biologically active ectodysplasin A1 and A2 immunoadhesins using the baculovirus/insect cell expression system

Ectodysplasin A (EDA) is a ligand of the tumor necrosis factor (TNF) family that has been shown to play a crucial role in ectodermal differentiation. Mutations of the syntenic ectodysplasin A gene (Eda) are responsible for Tabby (Ta) phenotype in mice and human X-linked hypohidrotic ectodermal dysplasia (XLHED). EDA-A1 and EDA-A2 are the two main splice variants of Eda, which differ from each other in only two amino acid residues and engage the tumor necrosis factor (TNF) family receptors EDAR and XEDAR, respectively. We have used the baculovirus/insect cell system to express the recombinant EDA proteins fused to the Fc portion of a truncated human IgG1 immunoglobulin heavy chain. Immunoadhesins (4.5-4.7 mg/L) from crude supernatant could be purified to near homogeneity by using rProtein A affinity chromatography. The purified EDA immunoadhesins were endowed with ligand-binding activity as they could bind EDAR or XEDAR on the surface of 293T cells that had been transiently transfected with the corresponding plasmids. Functional activities of EDA immunoadhesins were demonstrated by their ability to activate the NF-kappaB pathway in cells expressing their cognate receptors. These results open up the possibility of obtaining large amounts of purified EDA proteins to investigate EDAR/XEDAR related signaling pathways and for the treatment of patients with X-linked hypohidrotic ectodermal dysplasia.     

Rank order of success favors longer duration of imidazole-based therapy for Helicobacter pylori in duodenal ulcer disease: a randomized pilot study

Background. Studies on eradication therapy in developing countries have shown a success rate of 70–85%, which is suboptimal. Duration of therapy may be an important factor dictating eradication success in such regions. Aim. The study was undertaken to evaluate the effect of increasing the treatment period on eradication of Helicobacter pylori in duodenal ulcer disease. Methods. A randomized trial was carried out in which 64 consecutive H. pylori‐infected patients with duodenal ulcer disease were enrolled. The patients were randomized to one of the three trial arms. Therapy consisted of lansoprazole 30 mg twice a day (b.i.d.), amoxycillin 1 g b.i.d. and tinidazole 500 mg b.i.d. The treatment period was 1 week in group I, 2 weeks in group II and 3 weeks in group III. At inclusion, patients underwent endoscopy and the presence of H. pylori was documented by a positive urease test and C14 urea breath test. Four weeks after completion of eradication therapy, the patients were subjected to repeat endoscopy to assess ulcer healing and tests for H. pylori infection. Results. Sixty‐four patients (55 male and nine female; mean age 35.5 years) were enrolled in each group. The H. pylori eradication rate for group I (1 week of therapy) was 47.6%, that for group II (2 weeks of therapy) was 80%, and that for group III (3 weeks of therapy) was 91.3% (p = .003). The ulcer healing rates were 71.4, 80 and 95.6% in groups I, II and III, respectively (p = .09). Conclusion. The 3‐week regimen significantly improved the eradication rate as compared with the 1‐week regime. Increasing the duration of therapy significantly improved the chances of eradication of H. pylori in duodenal ulcer disease.     

Domain truncation studies reveal that the streptokinase-plasmin activator complex utilizes long range protein-protein interactions with macromolecular substrate to maximize catalytic turnover

To explore the interdomain co-operativity during human plasminogen (HPG) activation by streptokinase (SK), we expressed the cDNAs corresponding to each SK domain individually (alpha, beta, and gamma), and also their two-domain combinations, viz. alphabeta and betagamma in Escherichia coli. After purification, alpha and beta showed activator activities of approximately 0.4 and 0.05%, respectively, as compared with that of native SK, measured in the presence of human plasmin, but the bi-domain constructs alphabeta and betagamma showed much higher co-factor activities (3.5 and 0.7% of native SK, respectively). Resonant Mirror-based binding studies showed that the single-domain constructs had significantly lower affinities for "partner" HPG, whereas the affinities of the two-domain constructs were remarkably native-like with regards to both binary-mode as well as ternary mode ("substrate") binding with HPG, suggesting that the vast difference in co-factor activity between the two- and three-domain structures did not arise merely from affinity differences between activator species and HPG. Remarkably, when the co-factor activities of the various constructs were measured with microplasminogen, the nearly 50-fold difference in the co-factor activity between the two- and three-domain SK constructs observed with full-length HPG as substrate was found to be dramatically attenuated, with all three types of constructs now exhibiting a low activity of approximately 1-2% compared to that of SK.HPN and HPG. Thus, the docking of substrate through the catalytic domain at the active site of SK-plasmin(ogen) is capable of engendering, at best, only a minimal level of co-factor activity in SK.HPN. Therefore, apart from conferring additional substrate affinity through kringle-mediated interactions, reported earlier (Dhar et al., 2002; J. Biol. Chem. 277, 13257), selective interactions between all three domains of SK and the kringle domains of substrate vastly accelerate the plasminogen activation reaction to near native levels.