A Ruler Protein in a Complex for Antiviral Defense Determines the Length of Small Interfering CRISPR RNAs

Small RNAs undergo maturation events that precisely determine the length and structure required for their function. CRISPRs (clustered regularly interspaced short palindromic repeats) encode small RNAs (crRNAs) that together with CRISPR-associated (cas) genes constitute a sequence-specific prokaryotic immune system for anti-viral and anti-plasmid defense. crRNAs are subject to multiple processing events during their biogenesis, and little is known about the mechanism of the final maturation step. We show that in the Staphylococcus epidermidis type III CRISPR-Cas system, mature crRNAs are measured in a Cas10·Csm ribonucleoprotein complex to yield discrete lengths that differ by 6-nucleotide increments. We looked for mutants that impact this crRNA size pattern and found that an alanine substitution of a conserved aspartate residue of Csm3 eliminates the 6-nucleotide increments in the length of crRNAs. In vitro, recombinant Csm3 binds RNA molecules at multiple sites, producing gel-shift patterns that suggest that each protein binds 6 nucleotides of substrate. In vivo, changes in the levels of Csm3 modulate the crRNA size distribution without disrupting the 6-nucleotide periodicity. Our data support a model in which multiple Csm3 molecules within the Cas10·Csm complex bind the crRNA with a 6-nucleotide periodicity to function as a ruler that measures the extent of crRNA maturation.     

The potential of novel African isolates of Phthorimaea operculella granulovirus for the control of Tuta absoluta

Phthorimaea operculella granulovirus (PhopGV) is infectious for larvae of different Gelechiidae insect species, including Tuta absoluta and Phthorimaea operculella. As these are major economic pests in North and sub‐Saharan Africa as well as in the Mediterranean area, the development of locally suitable biocontrol agents is essential. We have studied five isolates of PhopGV from Tunisia (Tns16, Tu1.11 and Tu2.11), Kenya (Ken13) and Yemen (Ym14) for their biological activity and the sequence polymorphism of their granulin and ecdysteroid UDP‐glucosyltransferase (egt) genes and allocated the isolates to two different egt types. Infection experiments with neonate larvae of T. absoluta and P. operculella demonstrated their pathogenicity to both host species. The isolate PhopGV Tu1.11 was the most virulent one for T. absoluta but had a relatively low infectivity to two P. operculella populations originating from Italy and Tunisia.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Rho/Rho-associated kinase-II signaling mediates disassembly of epithelial apical junctions

Apical junctional complex (AJC) plays a vital role in regulation of epithelial barrier function. Disassembly of the AJC is observed in diverse physiological and pathological states; however, mechanisms governing this process are not well understood. We previously reported that the AJC disassembly is driven by the formation of apical contractile acto-myosin rings. In the present study, we analyzed the signaling pathways regulating acto-myosin-dependent disruption of AJC by using a model of extracellular calcium depletion. Pharmacological inhibition analysis revealed a critical role of Rho-associated kinase (ROCK) in AJC disassembly in calcium-depleted epithelial cells. Furthermore, small interfering RNA (siRNA)-mediated knockdown of ROCK-II, but not ROCK-I, attenuated the disruption of the AJC. Interestingly, AJC disassembly was not dependent on myosin light chain kinase and myosin phosphatase. Calcium depletion resulted in activation of Rho GTPase and transient colocalization of Rho with internalized AJC proteins. Pharmacological inhibition of Rho prevented AJC disassembly. Additionally, Rho guanine nucleotide exchange factor (GEF)-H1 translocated to contractile F-actin rings after calcium depletion, and siRNA-mediated depletion of GEF-H1 inhibited AJC disassembly. Thus, our findings demonstrate a central role of the GEF-H1/Rho/ROCK-II signaling pathway in the disassembly of AJC in epithelial cells.     

Genome-wide analysis of key salinity-tolerance transporter (HKT1;5) in wheat and wild wheat relatives (A and D genomes)

Exclusion of sodium ions from cells is one of the key salinity tolerance mechanisms in plants. The high-affinity cation transporter (HKT1;5) is located in the plasma membrane of the xylem, excluding Na⁺ from the parenchyma cells to reduce Na⁺ concentration. The regulatory mechanism and exact functions of HKT genes from different genotypic backgrounds are relatively obscure. In this study, the expression patterns of HKT1;5 in A and D genomes of wheat were investigated in root and leaf tissues of wild and domesticated genotypes using real-time PCR. In parallel, the K⁺/Na⁺ ratio was measured in salt-tolerant and salt-sensitive cultivars. Promoter analysis were applied to shed light on underlying regulatory mechanism of the HKT1;5 expression. Gene isolation and qPCR confirmed the expression of HKT1;5 in the A and D genomes of wheat ancestors (Triticum boeoticum, AbAb and Aegilops crassa, MMDD, respectively). Interestingly, earlier expression of HKT1;5 was detected in leaves compared with roots in response to salt stress. In addition, the salt-tolerant genotypes expressed HKT1;5 before salt-sensitive genotypes. Our results suggest that HKT1;5 expression follows a tissue- and genotype-specific pattern. The highest level of HKT1;5 expression was observed in the leaves of Aegilops, 6 h after being subjected to high salt stress (200 mM). Overall, the D genome allele (HKT1;5-D) showed higher expression than the A genome (HKT1;5-A) allele when subjected to a high NaCl level. We suggest that the D genome is more effective regarding Na⁺ exclusion. Furthermore, in silico promoter analysis showed that TaHKT1;5 genes harbor jasmonic acid response elements.     

Effect of training in Greco-Roman wrestling on neck strength at the elite level

Special training methods in wrestling have been assumed to improve the stability and tolerance of the neck. The aim of this study was to measure the neck strength levels reached in an extremely physically demanding sport. A neck strength measurement system was used to measure various parameters of maximal isometric neck strength in Finnish senior wrestlers competing at the international level. The results were compared with those achieved by junior wrestlers and a control group. The means (SD) of the maximal isometric neck strength for cervical rotation were 0.4 (0.1) Nm.kg(-1) for the senior wrestlers, 0.3 (0.1) Nm.kg(-1) for the junior wrestlers, and 0.2 (0.1) Nm.kg(-1) for the nonsportsmen. The respective results for cervical flexion were 4.4 (1.4), 3.8 (0.7), and 2.3 (0.8) Nm.kg(-1); for extension, 6.0 (1.1), 5.9 (0.7), and 4.0 (0.9) Nm.kg(-1). Neck strength in flexion seems to improve more than in extension as the result of wrestling. The greatest difference was found in rotation, which in the senior wrestlers was almost 3 times that in the nonsportsmen. There was great individual variation within all groups, and the results revealed weaknesses in all directions. Maximal neck strength measurements provide information useful in planning training programs to correct possible muscle deficiency and imbalance.     

Salinity in Drinking Water and the Risk of (Pre)Eclampsia and Gestational Hypertension in Coastal Bangladesh: A Case-Control Study

Background

Hypertensive disorders in pregnancy are among the leading causes of maternal and perinatal death in low-income countries, but the aetiology remains unclear. We investigated the relationship between salinity in drinking water and the risk of (pre)eclampsia and gestational hypertension in a coastal community.

Methods

A population-based case-control study was conducted in Dacope, Bangladesh among 202 pregnant women with (pre)eclampsia or gestational hypertension, enrolled from the community served by the Upazilla Health Complex, Dacope and 1,006 matched controls from the same area. Epidemiological and clinical data were obtained from all participants. Urinary sodium and sodium levels in drinking water were measured. Logistic regression was used to calculate odds ratios, and 95% confidence intervals.

Findings

Drinking water sources had exceptionally high sodium levels (mean 516.6 mg/L, S.D 524.2). Women consuming tube-well (groundwater) were at a higher disease risk than rainwater users (p<0.001). Adjusted risks for (pre)eclampsia and gestational hypertension considered together increased in a dose-response manner for increasing sodium concentrations (300.01–600 mg/L, 600.1–900 mg/L, >900.01 mg/L, compared to <300 mg/L) in drinking water (ORs 3.30 [95% CI 2.00–5.51], 4.40 [2.70–7.25] and 5.48 [3.30–9.11] (p-trend<0.001). Significant associations were seen for both (pre)eclampsia and gestational hypertension separately.

Interpretation

Salinity in drinking water is associated with increased risk of (pre)eclampsia and gestational hypertension in this population. Given that coastal populations in countries such as Bangladesh are confronted with high salinity exposure, which is predicted to further increase as a result of sea level rise and other environmental influences, it is imperative to develop and evaluate affordable approaches to providing water with low salt content.     

Interleukin 6 and/or Interleukin 17A Modulate the OPG/RANKL System of MC3T3-E1 Murine Osteoblast Cell Line

Cytokines such as interleukin-6 (IL-6) and IL-17 which act as key regulators of the immune response have been identified to have a potential role in the bone remodeling mechanism. Receptor activator of NF-κB ligand (RANKL) has been shown to regulate osteoclast differentiation and function while the osteoprotegerin (OPG) blocks the binding of RANKL and inhibits the differentiation of osteoclasts, thus favoring osteogenesis. Alkaline phosphatase (ALP) on the other hand works as early mineralization indicator in bone regulation. The current study aims to determine the potential role of IL-6 and IL-17A in regulating the OPG/RANKL system of the murine osteoblast cell line (MC3T3-E1). Gene expression analysis showed significant up-regulation of OPG and ALP by all the treated groups (rIL-6, rIL-17A and rIL-6 + rIL-17A). In contrast, treatment of cells with rIL-6 and/or rIL-17A showed down-regulation of RANKL expression. Interestingly, the osteoblast cells treated with combinations of rIL-6 + rIL17A showed marked increased in OPG/RANKL ratio. Similar pattern of protein expression was observed in the osteoblasts treated with rIL-6 and/or rIL-17A as detected by western blotting and ELISA. These findings suggest a new mechanism of regulation by these cytokines on the expression of OPG and RANKL, which could promote osteogenesis and diminish osteoclastogenesis.     

Accumulation of metals and metalloids in radish (Raphanus sativus L.) and spinach (Spinacea oleracea L.) irrigated with domestic wastewater in the peri-urban areas of Khushab City,Pakistan

Accumulation of different metals and metalloids was assessed in two vegetables radish (Raphanus sativus L.) and spinach (Spinacea oleracea L.) irrigated with domestic wastewater in the peri-urban areas of Khushab City, Pakistan. In general, the metal and metalloid concentrations in radish and spinach were higher at site-II treated with sewage water than those found at site-I treated with canal water. In case of radish at both sites the levels of metals (Cr, Mn, Fe, Co, Ni, Cu, Zn, As, Se, Mo, Cd, and Pb) were below the permissible level except those of Mn, Ni, Mo, Cd, and Pb. At both sites, the transfer factor ranged from 0.047–228.3 mg kg^?1 with Cr having the highest transfer factor. The metal pollution index in soil was in the following order: As > Fe > Ni > Zn > Cd > Mo > Se > Co > Pb > Mn > Cr > Cu, respectively. While in case of spinach at both sites, the concentrations of metals and metalloids in vegetable samples irrigated with canal and sewage water were observed below the permissible level except Mn, Ni, Zn, Mo, and Pb. At both sites, the transfer factor ranged from 0.038–245.4 mg kg^?1 with Cr having the highest transfer factor. The metal pollution index in soil was in the following order: Cd > Ni > Co > Se > Mn > Zn > Mo > Pb > Fe > Cr > As > Cu, respectively.