Design,Synthesis, and Biological Evaluation of 2‐(2‐Bromo‐3‐nitrophenyl)‐5‐phenyl‐1,3,4‐oxadiazole Derivatives as Possible Anti‐Breast Cancer Agents

Breast Cancer (BCa) is the most often diagnosed cancer among women who were in the late 1940’s. Breast cancer growth is largely dependent on the expression of estrogen and progesterone receptor. Breast cancer cells may have one, both, or none of these receptors. The treatment for breast cancer may involve surgery, hormonal therapy (Tamoxifen, an aromatase inhibitor, etc.) and oral chemotherapeutic drugs. The molecular docking technique reported the findings on the potential binding modes of the 2‐(2‐bromo‐3‐nitrophenyl)‐5‐phenyl‐1,3,4‐oxadiazole derivatives with the estrogen receptor (PDB ID: 3ERT). The 1,3,4‐oxadiazole derivatives 4a – 4j have been synthesized and described by spectroscopic method. 2‐(2‐Bromo‐6‐nitrophenyl)‐5‐(4‐bromophenyl)‐1,3,4‐oxadiazole ( 4c ) was reconfirmed by single‐crystal XRD. All the compounds have been tested in combination with generic Imatinib pharmaceutical drug against breast cancer cell lines isolated from Caucasian woman MCF‐7, MDA‐MB‐453 and MCF‐10A non‐cancer cell lines. The compounds with the methoxy (in 4c ) and methyl (in 4j ) substitution were shown to have significant cytotoxicity, with 4c showing dose‐dependent activation and decreased cell viability. The mechanism of action was reported by induced apoptosis and tested by a DNA enzyme inhibitor experiment (ELISA) for Methyl Transferase. Molecular dynamics simulations were made for hit molecule 4c to study the stability and interaction of the protein?ligand complex. The toxicity properties of ADME were calculated for all the compounds. All these results provide essential information for further clinical trials.     

Bacopasaponins with cytotoxic activity against human breast cancer cells in vitro

Molecular Biology Reports - Globally, breast cancer is a serious concern that exhibits a persistent rise in its incidence and related mortality even after significant advancement in the field of...     

Somatic embryogenesis and in vitro plant regeneration of Bacopa monnieri (Linn.) Wettst., a potential medicinal water hyssop plant

Bacopa monnieri (Linn.) Wettst. commonly known as waterhyssop, Brahmi plant, traditionally used for memory enhancement, nerve tonic, epilepsy, central nervous system (CNS), antidepressant, anxiety, blood pressure and antioxidant activities. Due to pharmaceutical demands its lost natural habitat. At this juncture we describe a resourceful protocol for micropropagation of water hyssop plant. Surface sterilized leaf and nodal explants were inoculated on basal MS semi-solid medium added with PGRs; auxins, cytokinins. Highest calli formation from leaf explants was obtained on NAA (2.5 mg⁻¹) and showed (94.22%) accompanied via 2,4-D showed (2.5 mg⁻¹; 82.43%), maximum calli formation in nodal explants was obtained on 2,4-D showed (2.5 mg⁻¹; 71.14%) followed by NAA (2.5 mg⁻¹) showed (62.15%), in internodes explants uppermost calli formation was obtained from 2,4-D showed (2.5 mg⁻¹; 65.21%) followed by NAA (2.5 mg⁻¹) showed (52.14%). The maximum somatic embryogenic callus, calli induction and formation (84%) was observed on 2,4-D + KIN (2.0 + 1.5 mg⁻¹) amended solid medium. Uppermost shoot formation was observed in combination of IAA + BAP (1.0 + 1.0 mg⁻¹) showed (78.54%) shoot formation followed by IBA (2.0 mg⁻¹) alone showed (75.37%). The maximum shoot elongation was noticed from NAA + BAP (3.0 + 3.0 mg⁻¹) with 21.21 cm followed by NAA (2.0 mg⁻¹) showed (15.22 cm) although, chief root formation was obtained from IBA (2.0 mg⁻¹) with 83.75% root formation along higher number of roots (47.43%) per shoot. Followed by IAA (2.0 mg⁻¹) showed root induction (73.43%) and no of roots (38.54%) per shoot. In hardening under pot condition plants survivability (100%) was observed under glass house conditions, the present in vitro PTC techniques is extremely significant to gratifying its natural conservation.     

Supervillin binding to myosin II and synergism with anillin are required for cytokinesis

Cytokinesis, the process by which cytoplasm is apportioned between dividing daughter cells, requires coordination of myosin II function, membrane trafficking, and central spindle organization. Most known regulators act during late cytokinesis; a few, including the myosin II–binding proteins anillin and supervillin, act earlier. Anillin''s role in scaffolding the membrane cortex with the central spindle is well established, but the mechanism of supervillin action is relatively uncharacterized. We show here that two regions within supervillin affect cell division: residues 831–1281, which bind central spindle proteins, and residues 1–170, which bind the myosin II heavy chain (MHC) and the long form of myosin light-chain kinase. MHC binding is required to rescue supervillin deficiency, and mutagenesis of this site creates a dominant-negative phenotype. Supervillin concentrates activated and total myosin II at the furrow, and simultaneous knockdown of supervillin and anillin additively increases cell division failure. Knockdown of either protein causes mislocalization of the other, and endogenous anillin increases upon supervillin knockdown. Proteomic identification of interaction partners recovered using a high-affinity green fluorescent protein nanobody suggests that supervillin and anillin regulate the myosin II and actin cortical cytoskeletons through separate pathways. We conclude that supervillin and anillin play complementary roles during vertebrate cytokinesis.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Importin‐7 Mediates Nuclear Trafficking of DNA in Mammalian Cells

Eukaryotic cells have the ability to uptake and transport endogenous and exogenous DNA in their nuclei, however little is known about the specific pathways involved. Here we show that the nuclear transport receptor importin 7 (imp7) supports nuclear import of supercoiled plasmid DNA and human mitochondrial DNA in a Ran and energy‐dependent way. The imp7‐dependent pathway was specifically competed by excess DNA but not by excess of maltose‐binding protein fused with the classical nuclear localizing signal (NLS) or the M9 peptides. Transport of DNA molecules complexed with poly‐l ‐lysine was impaired in intact cells depleted of imp7, and DNA complexes remained localized in the cytoplasm. Poor DNA nuclear import in cells depleted of imp7 directly correlated with lower gene expression levels in these cells compared to controls. Inefficient nuclear import of transfected DNA induced greater upregulation of the interferon pathway, suggesting that rapid DNA nuclear import may prevent uncontrolled activation of the innate immune response. Our results provide evidence that imp7 is a non‐redundant component of an intrinsic pathway in mammalian cells for efficient accumulation of exogenous and endogenous DNA in the nucleus, which may be critical for the exchange of genetic information between mitochondria and nuclear genomes and to control activation of the innate immune response .     

Smokeless Tobacco Extract (STE)-Induced Toxicity in Mammalian Cells is Mediated by the Disruption of Cellular Microtubule Network: A Key Mechanism of Cytotoxicity

Smokeless tobacco usage is a growing public health problem worldwide. The molecular mechanism(s) underlying smokeless tobacco associated tissue damage remain largely unidentified. In the present study we have tried to explore the effects of aqueous extract of smokeless tobacco (STE) on tubulin-microtubule, the major cytoskeleton protein that maintains cells morphology and participates in cell division. Exposure to STE resulted in dose-dependent cytotoxicity in a variety of mammalian transformed cell lines such as human lung epithelial cells A549, human liver epithelial cells HepG2, and mouse squamous epithelial cells HCC7, as well as non-tumorogenic human peripheral blood mononuclear cells PBMC. Cellular morphology of STE-treated cells was altered and the associated disruption of microtubule network indicates that STE targets tubulin-microtubule system in both cell lines. Furthermore it was also observed that STE-treatment resulted in the selective degradation of cellular tubulin, whereas actin remains unaltered. In vitro, polymerization of purified tubulin was inhibited by STE with the IC₅₀ value∼150 µg/ml and this is associated with the loss of reactive cysteine residues of tubulin. Application of thiol-based antioxidant N-acetyl cysteine (NAC) significantly abrogates STE-mediated microtubule damage and associated cytotoxicity in both A549 and HepG2 cells. These results suggest that microtubule damage is one of the key mechanisms of STE-induced cytotoxity in mammalian cells.     

Targeted Lipidomics in Drosophila melanogaster Identifies Novel 2-Monoacylglycerols and N-acyl Amides

Lipid metabolism is critical to coordinate organ development and physiology in response to tissue-autonomous signals and environmental cues. Changes to the availability and signaling of lipid mediators can limit competitiveness, adaptation to environmental stressors, and augment pathological processes. Two classes of lipids, the N-acyl amides and the 2-acyl glycerols, have emerged as important signaling molecules in a wide range of species with important signaling properties, though most of what is known about their cellular functions is from mammalian models. Therefore, expanding available knowledge on the repertoire of these lipids in invertebrates will provide additional avenues of research aimed at elucidating biosynthetic, metabolic, and signaling properties of these molecules. Drosophila melanogaster is a commonly used organism to study intercellular communication, including the functions of bioactive lipids. However, limited information is available on the molecular identity of lipids with putative biological activities in Drosophila. Here, we used a targeted lipidomics approach to identify putative signaling lipids in third instar Drosophila larvae, possessing particularly large lipid mass in their fat body. We identified 2-linoleoyl glycerol, 2-oleoyl glycerol, and 45 N-acyl amides in larval tissues, and validated our findings by the comparative analysis of Oregon-RS, Canton-S and w1118 strains. Data here suggest that Drosophila represent another model system to use for the study of 2-acyl glycerol and N-acyl amide signaling.     

miRNA Biogenesis Enzyme Drosha Is Required for Vascular Smooth Muscle Cell Survival

miRNA biogenesis enzyme Drosha cleaves double-stranded primary miRNA by interacting with double-stranded RNA binding protein DGCR8 and processes primary miRNA into precursor miRNA to participate in the miRNA biogenesis pathway. The role of Drosha in vascular smooth muscle cells (VSMCs) has not been well addressed. We generated Drosha conditional knockout (cKO) mice by crossing VSMC-specific Cre mice, SM22-Cre, with Drosha ^loxp/loxp mice. Disruption of Drosha in VSMCs resulted in embryonic lethality at E14.5 with severe liver hemorrhage in mutant embryos. No obvious developmental delay was observed in Drosha cKO embryos. The vascular structure was absent in the yolk sac of Drosha homozygotes at E14.5. Loss of Drosha reduced VSMC proliferation in vitro and in vivo. The VSMC differentiation marker genes, including αSMA, SM22, and CNN1, and endothelial cell marker CD31 were significantly downregulated in Drosha cKO mice compared to controls. ERK1/2 mitogen-activated protein kinase and the phosphatidylinositol 3-kinase/AKT were attenuated in VSMCs in vitro and in vivo. Disruption of Drosha in VSMCs of mice leads to the dysregulation of miRNA expression. Using bioinformatics approach, the interactions between dysregulated miRNAs and their target genes were analyzed. Our data demonstrated that Drosha is required for VSMC survival by targeting multiple signaling pathways.